Description :
From Genome Similarity Track
Location :
Scaffold_1951:2509- 6011
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1951-snap-gene-0.450S ribosomal protein L22
Pytar_ATCC12531maker-par_contig_1951-snap-gene-0.5Kinesin heavy chain

Sequence
3502 bases(100 bases per row)
TGGTGAGCTGCGTGTACAGCTTCTCGACGTTGCCGCGCGAGTCATTGACCATCGAGCGCCCGTCCTTCGTGATGACCTCGCCCTGCTCGTTCAAGAACAC
AAGCGCCGGGATCGTGCTGAGCCCGTACTTGGCAAAGAGTTCGGCCTTGAGGTCGCGCTTCTCGTACGGCAGCGCCTGGAACGGCATCTGCGTGTAGTAC
TCGTTGTAGCCTTCGACCTCGCGGTCCGACGAGACAAAAACGAGCTCAACGTCGGCGTGGTCCTCGACCATGTCGTCATAGACGGCCGAGAGGAACGGCG
TGAACGCGCGGCACGGCGGGCACCAGTGCGCACTGAAGTAGAGACCCACGACCTTCTTGCTGGCGAGCACCTCGTCCGTTGGCTTGACGCCACTCTTGGT
CAAGAGCTCATCGCCGAGCAGTTCCGTCCAGAGAGCCATGGCTCGCGTCGTCGAGCAGGATAATTCTGTTGTGACTCACAATCTGCGATCCAGGAGGAAC
GCGTGCCCAAGATTACGTATCGATCAAGTCGATAACGCCTCCGTCCCAGAAAATGGATGTTGACGGTTGTTAGCGAAGGTTATTGAATGTTGAAGTTGCT
TCCCAAGCAAGGTTGGATGAGAAGGCATCAAGCGCAGCAATGCACATCAGCAGTATCGAGACAACGAGAGAACTCATCACGTCCCTCCCGTGACGCCACG
CATCGGATTGGATCGAAAAGGACAGTCTCGGCATATTCAGGCGAAGGTGCGTGCAGTAGTAATGAGCTGAAGGTCGTATACAGTTACACAGTAATAGCAG
AGGAGGAGCAGAGTCGCCTCTCCTCGAGCAGCAACAGTTAAGCCAAACCGCACCATCCATACGGATGCCCATCAGCACTGCCGTCATGGGCAGTTACTTG
TATGCAAGAGAACTGGAGAAGGTCAAAGAAAAGATCGTTCTCTATTTACTCCTTCGAGACCGGCGCGGTCGTGGCCTTGGTCGCCTCGGCACGTGCGAGC
TTCTTGGTCATGAAGCGGTTGAGCGGCTTCTTCGACGGGTCAAACTCACGCAGCACGACTGTCAAGTGCGAGTGCGGGTGGTGCATGACACCCGAGCGGC
CTGCCATCATCAATGCCAAGCATGAGTATCAAGACCGATACCTTTGAGAATCAAATTGAGAACGCACCTCGGCCCATGATGCGCAGGCGCTTCAAGTACT
GGCCCTTGTTCACAAAGCACTCGGCGATCTCAAGGTTCTCCGGCTCGATCCGGTACTTGATGTCGGCCAAGTTGACCGCGTTCTGCACAGTCTTGCGCAC
GATCTCGGCCTTGCGCTTGGGCGAAAACTTCATCTGGAGAAGCGCCTCATTCGCTGGCAAGCCGCGAATCTACAATATACATAGCGATGCTCATTGAGCA
CGAGGTGCTGTCCCGATTAGCAGTGGCAGTGGTAGACTATACCTGCTGCGCCAAGTACGTGAGCTTGCGCGGGCTGTAGCGGATGTTCTGCTTCATGGTC
TTGACCGTGCGCATTTCGTCCGGCTCGGTCGCGTCCAGGAACGCGGCCGTGGCATCATCGTTCTCGGACGGCGTGGAGCTCTCGGTCGCCGCCGTCGAGA
AGCTCTTCATCGCAGACGAGCGCACCATGCAGGCGCCGCTGCCATTGCGCAGCGAGAGCGCCGTCAGTTGCGAGCGCACGACGCTCAACATGTTTCGCGA
CTTTGTTCGGCAGGATTTTCCCCGATAACTTTTCGCCCTTGGCGCCAGTGGTGGAGATTAGTTACCTGTATTGTACGATATTCGATATTGAAGGATTACA
TCACTATCTGCTACTAAATCAGTTCTATGTCCTCCTCAACCTCTACAGCGTATCAGTACATTTCGATCAAGATGCAATCCTAATGTCTCTCTTTGTGCGG
GTACTATTTCTCATCACTTCGGCAGTTGATAATGTGCAGGGATAGTGTTTCTTTCTCGCTTCGAGTGCGGGCTAGGAAAGGAGGTGGTGTGGGAACTAAC
GACTATGTGGTGTGGGTGTTTGTTTGTGGGCTGGGTCGGATTGAAGAGCAGAGACGGGAGCGTCATCAGCTTCTGTCTTTACACGAACGGCGACGCCGTG
CGCTTCTTCTTGTCCGAGATCCAAATGCGGAGCTTCTCGAGATCCTCAACCTGGGGGGCAGATCCTCCCTCGGCGGAGCCAGAGTCCCGGCCGAGGTCAC
CCGCGCCGAGATCCGGGCTCGTGATGCGGTCCACGACCAAGAAGCTCATGCGCTCGCCCGAGTCGTCGGGCAGCCACTCGATGTGGACCTCAATGTCTGT
GCGGTTGGACACGAGCGGCATGAGCTTGCCCACAAACCGCTGGCGGCTCGTGGGCGGCAAGTGCGGGATCTCAATGCCGCGGACCGTGATCTTGCTGGGC
GCCGTGCCGTTCACAATGTCGGCGATCCAGCCGCCCATGTACTCAAACTTGTCGGGTCGGTTCTTGCAAATGTCGCGCCGCAGCGAGAGGAGGAACTCGG
GCGTAAAGCGCTTGCATTTCTTCTGGAGTCGGTACTGCACGAGCGCTTCGTTTAGTGCCTGCATGGCCTCAGTGTTTTCCATGCCGTGGGTGCCAACCTC
GTAGCAGTCGTTGCAGAGGTGGTACGACGGGCAGACGCTGCAAGACCAAAGCGCGCCCTGGATGGACGCCACGCCGCAGCCTTCGCACATGACGTCCTTG
TGGACAATCGACTTCTTGCGCTTAAGCTTGGCCGCCATCATCGAGCCGCCGTAGCTCAGTGCCGAGCTGAACTTGGCCTTGGAGAAGCGGTTCGCAAGGG
CAGCCTTCTTGTCCCCGCCAAAGTTCCCAAAGATGCTGGGCTTGCTCACGCCGTCCGAGTGGGACCGCGGGTGGACCGTCAGGCGGTCGGGTGCCTCGAG
ACACGCGCGCGCAAACACGATCGTGCGGGCGCCGCGCTGCGAGTCCATGAGCTCTTCGACTTGGTCCTCCGTCATGTGCGGCTCAATGGGGTTGTCGTTG
ATGCTCAGCAGTGTGTCGCCGACGACGACACCGGCCTTGAAGGCCTGCGAGTCGCGCTCGACGGTCGCGATCCGTACAGCAAGCTCGGCCGTCTCCTCGC
AAATGCTCAGCCGTGTCGTGAAGCCGGCCGCGGCGGTATCACGGAACGTAACCTGGTACGAATTCAACGGCTGCTCGAGCGACTGCGAGCGGACAGACAT
ACCGGCAAAGTCCGAGGGCAGGGCCGTCGTGCGGTACGACGTCATGGACGCACGCATGGCCGACAGGTCGCTCGCAAACTTGGGCGGCTTGGCGTGGACC
ATGACGCGCCGCAGTCCGTGGAGCGCGCGTGCCGAGGTCGCATCGCCCGGTACGCTTGGCCCGAGGAAGCGATGGCACGAGTACTCTTCGTCGTCAAAGT
CGCCAAAGCCCGCGGGCCCACCGACGCCAAGGGGCGTGCCCAACTCGCTGTCGCTGTCGAGCAGTCCGCGGCCATTGTCTTCTTCATCGACGTCCGTGTC
GT