Description :
From Genome Similarity Track
Location :
Scaffold_36:250888- 252390
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13689hypothetical protein

Sequence
1502 bases(100 bases per row)
AACGTGATCTTCGTAGCGAAGTGCAGCACTCTTGGCAATCAAATTGCATCTGCTAGTATTCCTCTTGTCAACTCGAGCTCAGAAGACATAACGAACATCA
TCCATGTGCAAAACTCGTTTTCGCGTGGAGAAATCGTCGTTTCGTCATCAAATTCGACAACAGGCAGCGTGGAACTCAAATTTTACTCATCCGATGTACG
TCGCGTACCAGCGTACCCTTAGTGCTCTGGGCCATGATTCTAACGGATCGATTTTAGGGTGGATCTGTCGGAGCATCGGATATGTATATGAAAATGGTCA
AGAATGAGACGGTTGGTATCAATGTCTGGCCGATGGATGCAACTCAATTTCTGTGGTTAGATGGATCGTGTCAGGTATGCTGCATTGGATTTTTCCGTTG
TTTGTTTTATGTCTTACAATGACTGTGTAGCGGTCCATGATGGAGATTGAGTTGCCGCAAGAACCACTTCAAAGTCTTGTCGTGAACAGCAACACATCTG
TGGTGGTGAAAGCATCAGAAACTATGAAACTGCAAGGACTTAGCATTACGACAATGCAGTCCAGCGTCCTGTGCTCAAATGTTGAGATTCAGGGAGATGA
AGTTCTCCTAGAAACTACTTCGGGTGATATTAGTGTTGACAGCATGACAATCGACGCAAGCAACTCATCAACAGCAGAATCGCCGGCAAGAGTTTATTCA
GGGCTTGGGATCGTCAGTTTATCGAATGTGGTTTTATCTCAGTGTGATCTTCAAGTTGAAACGGGAGCAGGCAGTTTAGTGCTGTACGATGTTCATAGGT
AGCATTTCTTATGAAGTATTATTGGGGTGGTGTCGAACTAACTTGGCATGTCTTCACAGCTCTGTTAATACTGGGAGGAGTCATATTCAAGCCAAGAGCT
CCTCTGCATCGATTTCAGTGGACGACATACATGCAAACTGGATCACGTTGAAAAGTGGAACAGGTGATATCTATGGATCAGAGATATTAATCGAGGTAAA
GTCCCTTGCTAATCACGAAGTACAGTTAGCATTTGTGATACTTATTGGCGTATCATGCTTGATCAGGGCAACTCTGCCTTCATGGGTCGGCTAGAAGTCA
CAACAATATCGGGCGACGTCGAACTTAAAGAAATCACAACAAGCGGTACCATCCACGTAGAATCAGCCTCAGGCAAAATTTCGGTGCAACTAAATGTAAG
ATTTAGATTGCCATTATTACGCCCATCTCGTCGTCTTAATAGTTTTTGTGTGTGTGTGTGTACAGACCGAAACGTTTGCCGGTATGTATTACATGAGATC
AGAGTCCGGATCCATGTCCATTCGTCAAACCAATTATTCCAACGATGTCGTTGTAGAGGCGGAGGTAACAAACCTGAAAGTAGAATTCGATGAATGCTGA
TGTTAATAGGATTTTTGTTAATGCATGTACAGGATTCAATCGATGGGCTCGAGAAACACGGCAGTATCAACTGCGATCCAGCAGCCAACAACTGCATAGC
GT