Description :
From Genome Similarity Track
Location :
Scaffold_1366:2508- 3880
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1366-snap-gene-0.4Appr-1-p processing enzyme family protein

Sequence
1372 bases(100 bases per row)
GCCCCCGCACCCCTCTGCGGCGGTCTCGGCTTCAGCGCCGTTCGCTTTCGACGCACAGCTCAACTCGCGCGTCGCGCTCTGGCACGGCCCGATCTGGCGG
CTCGCCGCCGACGCCGTCGTCAACTCGACCAACGAGTCGCTGAGCGACACGTCGGGCCTCTGCCGCAGTCTGCTGGACGCCGCCGGCAAGGAGATCTGGA
CCGAGTGCGCGTCCGCGGGGCCGTGCCGCACGGGCGAAGCCGTCGCGACGCGCGGCTGCCGACTTCCGGCCCGCAAGATTCTCCACACGGTCGCACCACG
GTACAGCGATGCGTACAAGAGCGCAGCGGAGCATGCCCTCCACATGTGCTACCGCTCGGCGCTGAGCGCAGCGGTCGAGTTGCAACTCGCGAGCGTCGCG
TTCCCGTGTGTCTACGTCAAGCGCAAGGGTTACCCGCGGGACGCGGCGGCCCACGTCGCCGCCCGCACGGTGCGGCGCTTTCTCGAGCATTACAGAGACG
CCTTTGAGTGCGTGGTCTTCTGTGTCGACTCGCTTGAGGACCAGCTACAGTACGAAGCTGTTCTGCCGCTGTACTTCCCACGCGACCCCACGGAAGAAGC
ACAGAGTGCGCGTCTGCTGGAGGGGCGACCGCTGGGCGACGCGTTTGGCGAGCCTGTGATCGAAGAGCGCAAGATCCGCATTAGTGAATCACTGGTCAAC
GAGCCGCTGGATGGTCCGGAAGAGAACGGTGATCATGAACAGGATGCCGACGCGTGTGTCAAGAGCTTTTGCGAAATGTCGGCCGATCCGGACGTCGAGC
GGCTCGAGCGGCTGCGGAAGCTCCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCAAGAACCAGCCGAGCCAGCGAGTGCT
GCCGTACGCCACGGCTTTGGCGACGGCCAGGCAGCACGACTGGCGCGATCTCACGGCGCGCAAGTTCCTCTACAACGCCGGCGTCGACCACTCGGGTGAG
ACTGTGATCGTGTACATGGCCAGTCGGCTCAGCGTCACTGGCGGCGGCAGCAAGGCAGACGACGTCGTGGACCTCGAACGCGTCATGCTCTTTATCATCC
AGTTCATGGACGCGATTGTCGAGAAAAAGTACAGTGTGCTCTACGTCCACGACTCGTCCGCGAGTGACGAGACGCAGCTCAGCGCCGCGTGGCTGAAGCG
GCTCGTCAAGACGTTCTCGTCCAAGTACCAGCAAAATCTGCGTTTCTTCTATGTGTACGAGCCGAGCCTCTGGCTCAAGCTGCTGCTGCTAGTCGCCAAG
GGATTCGTGAGCAGCGCCTTCTACAAGAAGATTGTGTACTTGGCGTCGCCCGAGGATCTCGCCCACGTCGCG