Description :
From Genome Similarity Track
Location :
Scaffold_1230:2507- 5424
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1230-fgenesh-gene-0.2Heat Shock transcription factor
Pytiw_DAOMBR242034maker-piw_contig_1230-fgenesh-gene-0.1Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
2917 bases(100 bases per row)
AGCTCTCGCAGCCGCTTCTCCATGTTCTCGCTGCGCTGGCGCAGCTCCTTCATCTCGCGCAGTAGGTTGTCCGAGATCTCCCGATGTGCTTCCAGGCGCG
AGTTCTGCGCCGACGTGTTCACGAGCTGCTGTTGCTGCTGCTGTTGTTGCGAGGTCGAGCTCCCAGACGACACCTTCCGCTTAATGTAGTGCAGCAAGTC
GGGTCGGTCGCGCTTAAAGTACGGGTGCTGGAACTCGAGGCGCTTCGAGTCGAGCACGGTCTTGTGGAAGCCGTAGAGGTTGAGCTGACGCACGAAGGAT
GGGAAGTTGCGGTGCTTGAAGAAGCGCGGCAGCACGAGCGCCACGAAGGCCTCGAGCTGCGAGACGATGATCGTGTCGCCGCTGGCGTTCCAACCGCAGA
TCGTCGCGAACTCCTGCATGCTGAAGATCTCAAACGTCTTGGAGAGGAACGCCGGCAGCATCACGTGCTTGCTGTCAGTCGAGTTGGCTGCCGCGCTGGC
CTGTGCTGCTGGGCCTACAAGAACCACAACATACTCGTCACCACCACCTTCCTCTCACTATACACAGCACAATACACACACACGCAGACGCACTCTTCCC
CTTGGCGGCCTCGCCTCCTGTCTGCGCCCGTGAGCGCGTCGCCACGCGCGCGTTCTCGTCCTGCGCGAGCGGCGCGATCGTGAGCTCGTGCAACTCTGCG
TCGCGGTCCGCACTGCTGCTGTCGCTGCCCATGGCTTTGTTGCTGGCGACTCGTACGCGCTTGGCCATCGGTCCGCCGTCTGTCTCTCTCTGGACGCGTC
TTCTTCTCACTCGTGCACGTAATCCGGCACGCGTGCGTCTGTCGTGTTCCTCTTCGTCCGTGTTTCTCTCTCTCGTGGTTGGCTGGCGGCCGATTTTGTA
TCGCGGAAAACTGTCGTTGAGGCTCGCAGCATAGTTTAAGCAAGATGCGGGAACAAGAGGTCGAACTGGTGTTTTTCGAAAAACCAAAATCCTTCCCGAG
GAGGATGAGCCACAAGAATATCCTGTAGAAATCTATTGTTTACCTGTAATAATCGATACGCCGACCCGACCAAGATCCGACCTTGTGCGAAACGAGCAAG
CTCGCAGAGGTTCAAACAGCTCGCAAATTTATACTGATAGGCTAGTAGTGCTCGCAGCAGTAGCCTTCACCGTGCATTTGCCAGTTGGTCAACGCACTTT
CGGATTTGATGTGGGTATTGTGAGCGAAAATCTCGTGCAATAGAGTGTCGGACTTTAAATTAGCAAGTCGGCCCTGACGTCGGACTGGATTTATACCCCA
GCTCAATCAAGCTTGGTTAAGCTCGTATGAGTCCAGGGAAAGCCACACGAGCGGATCAAAGACCAGTCAGTTGGTCTCGAGGCGAGATTGCCTTCCTTCG
ACATCGCACATTCATGTCATGTTGCCTCGCTGTGACAGCAAGTCTTTGAGTCCATAAGATGTAATTTTATCAAAAATAGAGGTCATTTACGTTACTCTTC
ATATACCGGTATAAATATCGGTATTGATTGATTGGCAAAAATCACACGACACACACACAAAAGAAAATCAGGCGAGCGGACAGCTCCTCTCTTCCTCCTT
CCTCTCTTCCTCTGTATGGACGCGGCTGCAGCAGACGCAGCAGCGGAGGAGGCCATGAAGATGGCGACCGCACAGCCGCGACGGATGTCGTCTGCGGGGA
TGGCGCCGCCCACGCGCACGCGCACGCTCTGGAAGGGCGTGGACGCGTTCTTCCAGCTGGCCAACACGTACTACACGGGCCGCCTCGCGCTCTCGACGCT
CTGCTCCTTCCTCTCGCTCGCGCTGCTCTGCGTCTTCGCGCAAGACAAGTCGTTCGTGGTCTGGGTCTGGATCGCGCTCCAGGTGCTCAACGTGGCGCTT
GGCGTCGCGGCGCTGCCCGGCGTGCAGCTCTACTCGCGCGGCGCGCCCGGCGACGACGATGACGACGAGAGCAACAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTACAATTACGGATCGA
TCCATCGGAACGACAACCGCACGAGCTCGTTCTCGTTCCTGCGCCTCGCAGTGTACAGCGCCGACAAGGAGGGGCGCCAGGAGTTCAGTCTGCGCCGCTC
CGTTGTGCTCTACGCGTGCGAGGTGGTCGTGATCTTCCAGACCGTCTCGCTCGTCTGGGTCGTGCTGCTGCTCATCGGCGTCTTCTGGGCGCACAGTGAG
TTGGACGAGATGTGGAACGAGCATCTCTCCGACGCGACCACCATCCTCTCGATCTTCGCCGCGCTCTGCATCGTGCTCCAGGTGATGCAGTTCGACCGCC
TGCGCACGCACCAGCAACTCCAGCTGGGCGCCGGGCTGGAGGAAGCAGACCAACCTACCACGGTGGCCTTGAACGACCAAGAGTCCTCGCGCTCCAGCAG
TACCCATCAAGTCACGGGCAACGCCGACGTGCAGGCGCGACTGCTGCGCCCGAACGTCGACAGCTCCATCTCGGACAACGAGAAGCTCTTGCTGGGCTCG
ACGGCGAAAGGCCTCGAGCCAAAGCTGCGCGCGTCACTGTACGAGGCCGTGCTGGACGGCGACTACATCAAGGTCGAACAGCTCTTCACACACGCCGAGC
ACGTGCTTGGCTCCAAGGTCAAACTCCAGCTGCTGCTGCTCGACATGTACAACACGCCCATGCTCGTGGGCTGGTCCTTTGCGCGCTCGACGCTCAACCC
GCTGCACGTGGCGAGCC