Description :
From Genome Similarity Track
Location :
Scaffold_48:250647- 258515
Sequence
7868 bases(100 bases per row)
TATCGTGGTTTGGTACGCTTCGGTTACACCGTACTACAGGTTTGGATGTCATGTTCTTCAATGGCCGGCGCTCTTCCGTGATCGTCCTGGCTTCGAGGCT
CCCTGCTCACCCGTGGCACACGCTGCTTAGTGGTTACGCGCTCTCTCTTTTGGGGTCATGCTCTTTAGTACGGCCTCATTTGTGGCTGCTAACCATTTTC
TGTTCTCAAATGTTTTCGTGGGTTGCACCGGCTTCGTGGTACATCGTATTTCGTGGCCGTTGGCCTCCCATCGCCGGTAAGCTAGCCGAAGGGTGCTATT
CCGTGGTTTGGTGCCTCCACGTAGTCATGTTGTTCCGTCGCTCGTGTATCGTGCTCTCCTGGTGAGATTCCATCGACTGCGCTACGACGCTATCGAGCAA
TCGCGGTGTGGTAATGACATTTATAGTATTGTGCTCGCGTAGTGCATCTGCGTTGTCCGTGTTATCGTGCTTTACAATGGCATCGTGCTCCACGGTGTGC
AATCGTGGACACCCCCCGTGTATATCGTGGCTGGTCCGCCGTCCGTGCAATTGTGTTCTCATGTACTACTGTCCTCCGTGGCTCGGTAAGCTCAAGTTGG
ACACTGGTATGGTTTTCCGTGACGCGGTGATTTCGCGTGGCTGCGTGCTCTCCGATAGTTTAGTAGCTAGCCCAACGTCCATGCTGTCGTGTTATTTCTG
GTGTCGGGGCTGGTCGGTCGTCTGTCTTATCGTTAGCTACCGTAGTGTAGCTCTCCGTGGATCGGTGAGCTCCTGTTCTACCCAGGCATCGTGCTCCAAA
GATTGATGATTTCTGATTTCCCGTGTCTGGCCTCCCGCGGGCTCAGGTTTGGTCGGTTGGCTGTGCTCCATGTTTACCCGTAATGTTGTTGGAGAATTGT
TTCTGTGCACGCTCACCGGTACGTGTTCTACTGTGGCTTCGAACGTTCATGCTCTTCCGTAACCCGTGCTTTTCAGCAGACTGGGGTGTCTTTATATGTA
GTTCCCTTCCGTGGCCCGTACGCTCCCGTCATATTCTTGTCCTTCTGTCCTTTTCATGGCTGTGGGCTCTTCCGTCTTCCACGCTACGCATACAACTTTG
TGGTTTGCATCGGCTAAGTCTTCTGTCCTTCCGTGCTTCATGTTGCTCTTCTATCACATCGTGTACATAGTGTGGGTCGGTGGTACTTCGTTTTCGTGTT
CTTGCTTAGTCACGTGCCTCCGCGCTAACTTAATCACAAACGCTGTTCCCATTTGGTTTGATGTACGCAGCATATATTGTTGGAAAGCTTACACAATCTC
TTAAGGTCGCACACTACGCGCGCAAATACAAAGGAAGACGATACTTTCTTACGGAGGTAGTCTGGGGTGCAGGGGTGTAAGCCACAATAGTCATATTTTA
CTGCTTCGCATTATTAGCTAAAAGTAATACAATTGTGATTTATTTTCTAACGCTGAAATTTTTTATGTGTACTACTACTACTACTACTACAAATGACTGC
AAGCAAAAATATGAGATGCCCTAATAATAGTACTAAGCAAAATAATATTGTAAGTTAAATTAGTACAGCACTACTACGAAGCCTAAAAATCATTCTATAT
TCAATAAGTACTAAAGTTTCGATTGAGGCCGAAATAAAAGTCACCGAAGCCTACAAATATTTTCTACAGCTCCTACGAAGATATACTACGTGTGTGCTCA
TCTACACCTTATACCAATGCTAACTAACGCGTACACAGGCAGCGCCCTTTGCGTGGCCTTGCATACCGCAGCTGAAAATGAGAGCAAAATGAAATTTAAG
CGGCGCTTTTAAGTACGATGTGTAGTCCACATATAGTGTGGTCAAAACACAATTCCGATTTTAGCCAATGGGGACCGCCTTCGCTGCGCTCGGCAGCTTT
TTAGCGAATCGAGGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCGCGTATTAGCGTGAGTTTTATTAACCCTAGCCCGTTACGGACGGAATGACGG
ACGCAGACCACACTGCACTAGATGTTTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGAGATGAGGTGGCCACAAATTTAA
TGCTTCTTGGTGTCGCGTGTTTTGTGAGCGTCGTTCACCCCAGTATGTCGTGGCTTCGTTTACTAAACCACTTACCTTTCCGTAATCTCATGTGGACCCG
TTTAATATTGTCCTTCCGTTTCCCCGTACTACAGGTTGGATGTCATGTTCTTCAGTGGTCGGCGCTCTTCCGTGATCTTCCTGGCTTCGTGGCTTCCTGC
TCGTCCGTGGTCCATGCTGCTTAGTCCCTTTGCGCCCTCTCTTTTGGGTTCATGTTCTCCAGTACGGCCTGTTTCTACCTATTCCCGGTATTCACCGTTT
ACATGGGCTGCACCGGTTTCGTAATACATGGTCTTTCGTGGCCGTTGGACTCCCATCGCTGGTACTCTAGCCGAAGGGTGCTATTACGTGGTTTGGTGCC
TTCGCGCAGTCGTGTTGTTCCACCGCCCGTGTATCGTGCTCTCCTGGCGAGGTTCCTTCGACTACGTTATTACGTTATCGTGCAACTCCGGTGTGGTAAT
GCTGTCTAAGGTATTGTGCTCGCGTAGTGCATCTGCGTTTTCCGTAAATTATCGTGCTCTACAATGGCTTCGTGCTCCGTGGTGTGCAATCGTGGTCACT
CAAGCACCCCCGTGAAATTTGTGGCTGGGCCACCGTCCGTGCCATCGTGTTCTAATGTCGTACTCTCCTCCGCAGCTCGGTAAGCTCAGGTTTTACACTG
GTATCGTGCTCGATGGCTCGGTGATTGCTCGTTTATGGCCTCCCGCGGCATCGTGTCTGGTTCGTCGACCGTGCTCCGTGCTCTACCGTGGTGTTATGGG
AGAATTGCTGTCAGTGCACTCTTTCCGCTACGTGCTCTACCGTGGCTTCGAACGTGCGTGCTTTTCCGTAGCTGTCCTATTCAGCATGCTGTGGTGTCAA
TATATTTAGCTCCCTTCCGTGGCCCGTACGCTCTCGTCATATTCTTGTCCTTCTGTCCTTTTCATGGCTGCGTGCTCTTCCGTCTTTCAAGCTACTTATA
AAACTTCGTGGTTTGCATCGGCGAAGTCTTCCATCATCGTTCATTGCCTTCCGTGCTTCGTGTTGCTCTTCTATCCTATCATGTACATAATGGGGCATGG
TGTTACTTCGTGTTTCGTGCTCTTGCTTAGTCACGTACCTCCGCGCTAACTTAATCACAAACACTGTTCCCATTTTTTTTGTACGCTACATATATTGTTG
GAAAGCTCGCACTATATCTTAAGGTCGCACACTACACGCGCAAATACAAAGAGGAGAAGATGATACTCTTTTCCTCGGAAGGCAGTGTGGGGCACAGTCA
CACAAAGTCATATTTTAAAGCTCTTCACATTATTATTAATAGTAGTAAAATTCTGATTTATTATCAAGCGCCTGATATAATAGTTTTATGTACTCACCTT
CTACGCAATATTCTGCAAGCAAAAATATGATATGAAATGTCTTTAGAAATAGTACTACGCAAAACAGTTTTTCTTAGTTTAACTATTAAAAAAGTACTAC
GAAGCCTAAAAATCATTCTAGATTCCAAAATTTCCCAATTTTAAAAAAGTAATAAAGATTTTTCCGATTGAGGCGCGAAAAAAAAGTCCACCAAAGCCTA
CAAATATTTTTTTCACAGCTCCTCTCACAGAAGATATACTAGCGGGGGGGGTCATCTACACCTTATACTCTCCAAAAAGAGTGTTTAACTAGACGCGTAA
CACAGGCAGCGCCCTTGCGTGCCTGCATACCGCAGCTGAAAATGAGAGCAAAATGAAATTTAAGCGGCGCTTTTAAGTACGATGTGTAGTCCACATATAG
TGTGGTCAAAACACAATTCCGATTTTAGCCAATGGGGGCCGCCTTCGCTGCGCTCGGCAGCTTTTTAGCGAATCGAGGCCGCCTTCGCTGCGCTCGGCAG
CCAGTAGAACGCGCGTATTAGCGTGAGTTTTATTAACCCTAGTCCGTTACGGACGGAATGACGGACGCAGACCACACTGCACTAGATGTTTAAGACTAGC
CGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGAGATGAGGTGGCCACAAATTTAATGCTTCTTGGTGTCGCGTGTTTTGTGAGCGTCGTTC
ACCCCAGTATGTCGTGGCTTCGTTTACTAAACCACTTACCTTTCCGTAATCTCATGTGGACCCGTTTAATATTGTCCTTCCGTTTCCCCGTACTACAGGT
TGGATGTCATGTTCTTCAGTGGTCGGCGCTCTTCCGTGATCTTCCTGGCTTCGTGGCTTCCTGCTCGTCCGTGGTCCATGCTGCTTAGTCCCTTTGCGCC
CTCTCTTTTGGGTTCATGTTCTCCAGTACGGCCTGTTTCTACCTATTCCCGGTATTCACCGTTTACATGGGCTGCACCGGTTTCGTAATACATGGTCTTT
CGTGGCCGTTGGACTCCCATCGCTGGTACTCTAGCCGAAGGGTGCTATTACGTGGTTTGGTGCCTTCGCGCAGTCGTGTTGTTCCACCGCCCGTGTATCG
TGCTCTCCTGGCGAGGTTCCTTCGACTACGTTATTACGTTATCGTGCAACTCCGGTGTGGTAATGCTGTCTAAGGTATTGTGCTCGCGTAGTGCATCTGC
GTTTTCCGTAAATTATCGTGCTCTACAATGGCTTCGTGCTCCGTGGTGTGCAATCGTGGTCACTCAAGCACCCCCGTGAAATTTGTGGCTGGGCCACCGT
CCGTGCCATCGTGTTCTAATGTCGTACTCTCCTCCGCAGCTCGGTAAGCTCAGGTTTTACACTGGTATCGTGCTCGATGGCTCGGTGATTGCTCGTTTAT
GGCCTCCCGCGGCATCGTGTCTGGTTCGTCGACCGTGCTCCGTGCTCTACCGTGGTGTTATGGGAGAATTGCTGTCAGTGCACTCTTTCCGCTACGTGCT
CTACCGTGGCTTCGAACGTGCGTGCTTTTCCGTAGCTGTCCTATTCAGCATGCTGTGGTGTCAATATATTTAGCTCCCTTCCGTGGCCCGTACGCTCTCG
TCATATTCTTGTCCTTCTGTCCTTTTCATGGCTGCGTGCTCTTCCGTCTTTCAAGCTACTTATAAAACTTCGTGGTTTGCATCGGCTAAGTCTTCCATCA
TCGTTCATTGCCTTCCGTGCTTCGTGTTGCTCTTCTATCCTATCATGTACATAATGGGGCATGGTGTTACTTCGTGTTTCGTGCTCTTGCTTAGTCACGT
ACCTCCGCGCTAACTTAATCACAAACACTGTTCCCATTTTTTTTTGTACGCTACATATATTGTTGGAAAGCTCGCACTATATCTTAAGGTCGCACACTAC
ACGCGCAAATACAAAGGAAGATGATACTTTTTCCTGGAGGCAGTGTGGGGCACAGTCACAAAAGTCATATTTTAAAGCTCTCACATTATTATTAATAGTA
GTAAAATTCTGATTTATTATCAAGCGCTGATATAATAGTTTTATGTACTACTTCTACGAATATCTGCAAGCAAAAATATGATATGAAATATCTTTAGAAT
AGTACTACGCAAAACAGTTTTCTTAGTTTAACTATTAAAAAAGTACTACGAAGCCTAAAAATCATTCTATATTCAATAAGTACTAAAGTTTCGATTGAGG
CCGAAATAGAAGTCACCAAAGCCTACAAATATTTTCTACAGCTCCTACGAAGATATACTACGTGTGTGCTCATCTACACCTTATACCAATGCTAACTGAC
GCGTACACAGGCAACGCCCTTTGCGTGGCCTTGCATACCGCAGCTGAAAATGAGAGCAAAATAAAATTTGAACGGTGCATTTAAGTACGATGTGTTGACC
ACATACAGTGTGTACAAAACACAATGCCGATTGACTATCCGTTTGCCGCCGCTACGCGGCGGAGTGGCATGGCTTGTTGGAGATGCGGTGGCCGCAAATT
TAAGTGCTTCTTGGTGTCGCGTACTTTATTAGCGACGTTCACCCCAGTAGCGCTTGGCTTCGTGTACTTAACCATCTACCATTCCGTAGTCTCATGTGGA
CCCGTATGTTATCGTTGTTTGGTACGCTTCCGTTACCTCGTACTACAGGTTGGATGTCATGTTCTACAGTGGCCGGCGCTCTTCCGTGATCTTCTTGGCT
TCGTGGTTCCCTGTTCACCCGTGGCCCATGCTGCTTAGTGATTGTCCTGGATTTGTGGACTCATTCTCTCACAGTGCTGAGTGGTTGTGCGCTAGCTCCT
TTGGTCTCATGCGCTCCCGTAGTACGACCCTCTTTCGTGGCTGCTAGATATTCCGTGTTCTCAAGGGTTTACGTGGATTCCACAGGCTTCGTGTCCATAA
TCATTCATGGTCGATAGCGTTCCATTTCTGGTACCCTCGTCAATGGGTGAACCTCCGAAGTTTTCTGTCGTCTGTGTGTCGCGCACCCCTGTGGTGGCTC
CATCTACCGCGTTATCGCGCTATCGTGCAATCGCAATGTGGTTATGATGTCTATGCTATCGTGATCGCATAGTATATATGTTTTGCAAATGTTATCGCGT
TCTACGATGGTTCCGTGTTCCGCGGTGTGAAATCGTGGTCTCCAGAAGCGTTTCTTTGCGATTTTGTGGCTGGTCGGCCGTCCGGGTAAACGTGTTTTAA
TGAAGTATCGTCCTCAGTGGCCCGGCGATCTCAGGTTCTACAGTGCTATCGTGCTCAGTGGCTCGGTGATTTCCCGTGGCGGCTTGTTCTCCCATGTTTT
AGTGGCTGTCCCATCGTCCATGCTACCGTGCTATCTCTTGGTGTCGCGGTTGGTCTGTCGTCCAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTCCGTAAAATTATCGTGCTCCTACAATG
GGCTTCGGGCTCCCGTGGTGTGCAAATCGTGGTCACTCAAGCACCCCCGTGAAAATTTGTGGGCTGGGGCCACCGTCCGTGGCCATCGTGTTCTAAATGT
CGTACTCTCCTCCGCAGCTCGGGTAAGCTCAGGTTCTACACTGGTATCGTGCTCGATGGCTCGGTGATTGCTCGTTTTATGCCCTCCCGCGGCATCGTGT
CTGGTTCGTCGACCGTGCTCCGTGCTCTACCGTGGTGTTATGGGAGAATTGCTGTCAGTGCACTCTTTCCGCTACGTGCTCTACCGTGGCTTCGAACGTG
CGTGCTTTTCCGTAGCTGTCCTATTCAGCATGCTGTGGTGTCAATATATTTAGCTCCCTTCCGTGGCCCGTACGCTCTCGTCATATTCTTGTCCTTCTGT
CCTTTTCATGGCTGCGTGCTCTTCCGTCTTTCAAGCTACTTATAAAACTTCGTGGTTTGCATCGGCTAAGTCTTCCATCATCGTTCATTGCCTTCCGTGC
TTCGTGTTGCTCTTCTATCCTATCATGTACATAATGGGGCATGGTGTTACTTCGTGTTTCGTGCTCTTGCTTAGTCACGTACCTCCGCGCTAACTTAATC
ACAAACACTGTTCCCATTTTTTTTTGTACGCTACATATATTGTTGGAAAGCTCGCACTATATCTTAAGGTCGCACACTACACGCGCAAATACAAAGGAAG
ATGATACTTTTTCCTGGAGGCAGTGTGGGGCACAGTCACAAAAGTCATATTTTAAAGCTCTCACATTATTATTAATAGTAGTAAAATTCTGATTTATTAT
CAAGCGCTGATATAATAGTTTTATGTACTACTTCTACGAATATCTGCAAGCAAAAATATGATATGAAA