Description :
From Genome Similarity Track
Location :
scaffold_930:2506- 4046
Sequence
1540 bases(100 bases per row)
CTCGGCACCAGCATCGATCAACATTCGTGTACGTGTCCGTGTGTCCATATTCTGCCGCAAGCATGACCAAATTTAAGCCCGACCCAGATCTGACCAGCGT
CTGAACGATGTCATTGCGTCATCGTCCAAACCGTGCAGCATACATAAGTGCTGACCAATTGCTCCTGTTGACCAAGTTATTGTACTGTCAGCACCAGCGT
CGATCAGCATCCGAACGGTGTCAGAATGCCCGTTCCAAGTAGCGACCATGAGTGCTGACCAATTGGTGTCGTTGATCAAATTCACGTCAGTACCAGCGTA
GATCAGCGTTCGCACCGTTTTAGAGTTTCCACATTTAGCTGCTTCCATTAACGAGATAGAGGACTTCATGCCGTGCTGCGACGTAGGAATCACAGACCTC
TAGGGCAAAATTGGATTTCATGATTAACATGTTGGACATATTATCAGCCAATAATGTGCGACTACTAAACAATATATTGCCAATAAAACTTTGTATTGTA
TTGAATGGGAAAGTATTGTATTGTATTGTTTGAAGTATTGCAATCAAAACTTTCCTCCAAACGAGTCTTCTGTGAAACGTCGAGTTGAGATTCTACAAAA
CAGTTTCTTAGCCACGTTGTCATTTTTCTTGAACCCACTCAATCCGCTCTACCGTAGTTTAGCACTGCTACCAGTGCTCCAGTTTACTGTTGTATAGAGG
CAGGTTTTCTGCTTTCATGGCTACTAAGTACTACAACCTGACGCTGTGTAAATGCTCGTCAACGCTCGCAGTGGACGTAAACGGCAAGGCACCGCTCATT
TATACTGCGCAACACGCTACCACGGACGCTTGGGACGAGTCTGTTAAGATTGCAAGCATTCTGGTCGAGGCGTGCAGATGTGATGCAAACCGCATTTCTA
AAAGCTAGTGCGAACATTTCGCACGAACTCGTCGATATTCTGCTCCAGCAAGGATCCCGAGTTGACTACGCCTCACTTAGCGTGGTTCAATCCGAGGACG
TCCGCTCAGCTGGAACGTTCCAATCAGCAATTTCATGACAAACCCACCTGGACCGCCACTGTCGAGTGGCCAAGTGTTGGGTCTTCATTTGAGACCGCGG
CGAACAAAATGATACTTCTCCACCATTTAGAGTTATCGAGATAATCGCGTTTGAAGTTGACCAATCAAAATTCGTACATAATCGAACATTAAAATTTTGA
AAGCGAAAATCACTCGTAAAAAGCGTTAAACTACGCATATTCAATTGCTTTCTACACGGCCTTTTCGACAATATACAAAGAACAAAAAACCGAGCAATAT
TGCATTCACAACTTTCCCAAACATGTGAGGCCTTGAATATGGAGATATTTTTTTCAGATGAGCACTGCAGCTCGGCTATTGAATATCTCGAGGCGTACAG
GGGCTCAAAATAAGCACAAGACACGGCTCTATCGAGTAGTGTGCCTAAATCGCGATTCGTACTTTGGTCGATTAGTATATTTGTGTTTGACGCCGTCTCC
TTTGGCCTATCGTCGAGCACTTGCTGCTGAAGAAGCGAGC