Description :
From Genome Similarity Track
Location :
Scaffold_146:2506- 4035
Transcript NameFunction/comments
Phyag_g2712hypothetical protein

Sequence
1529 bases(100 bases per row)
GCAGTCTCCGTGTGCATTTGGCGTTCCAGTGCCTTCTGTGCTTTttgcaccagcaacgcgagCAGTGACCGATCTTTTGCTGGACGTTGTTTAAGTTTCT
CCGGTGCTGGTAGTCGCTTGTCAACAGCTTCCTGGACGGAACGCGGTAGCTCACGAGATATGAATTTGAGAATCTCCACACGATACATGCAAGTTGTCTC
CGCATCTAGGAGCATCGGGTCCGAAGAGGAAGGTGACGCCTGTAGCAGTGCCAGCTTCTGACGAATATCGGAGCCCACAGCTTCTCccacagcgtcagca
tcCGCTTCGCGCGTTGGTTCTTTCTGGTCGCGGTGCACGCGCAAGAAGCCCGTAACACGCGCAGTGATGCATGCCAACAGGTCTGTACGGATCTCCGAGG
CAATACGACTTAGTTCACGAACTGCTACGTCCTCGGGTGACCGGATACCGTATGCTCCCTGGGGTTCCGAGACGGAAGTAGTCGAGTCTACGCGTAGACG
TTTAACTGGCGAGCGATTTGTTGAAGGAGATGGTGGATTGAGTGGAGTCGTTTGATACcaacgctgttgctgctgactgtACGAAGGAGTGCCGACGTAG
CTATGGTTGGGTCGCGGACTCGGGCTTGGTCGACTACTTGGACTTAAATTCACCATCAGCGACTGCACCGGTCGTAAATGAAAAGATCCTGACGCAGGAG
TCCGAGGTGTCCTGATGTCTCGAGGTGTACCTTGCGGTTGCAGTCcctgacggagctgcagtaACGCTAATTGTGGTCCGGTGACGTTGGCAGTAGCTGT
TGGGCTGGGTAAAGCAATCGAAGGTAGGTGTCTAGCCTGCGTCTGCGCTACCGAAGGAGAGTTGGTAAACCCCACAGCCTGAGCAGCAAAGTTCGCACTC
TTTCCTCCGTCATTCTCCGCGCCGTTAAAACGCTGCAacaacgactgcagcagtccaGCCAGCCGCTGGTTGGtcctctgcagcttgttcatCTCCTCTC
TCAGTGCGCCCACCTCAACCTTTAACTCATCAAACTCAACACGTTCCACGGGCGTCCGTTCCCCTACCGGGGTCGCCACCTTAGCATCACTAGGCGAGCG
TCTCCTGATCTCACACAACAACTCCCTCCTTCCCCTCACAAACCGCTCATGGCGGAACTCCCACCAATCTTTCGGACTCGCGTCATCAATTGCCCCCTCT
GCTTCTGCGCTCGTGTCCGTCTCCACTGGtatcgacgacgccgacgcgcGCACCTTCCTGAATCCATAGAGGTTGAGTTGCCGCACGAAGGAGCTGAACT
TGCGGTGCTTGAAGTACGTGGGGATCACGTGCTCGGCAAAGGCTACGGGCTGTTTCACCACGAAGCTGTCCCCTTTGGCCGTCCAGCTGGCCAACTCCAC
GGGAcagcgctccagcagctcgtacgtcttctccaggaacagcgcggcttcttctcgtcgcggGCGCTTGCGTCCTGATTCGCTGCCGGGcgtgtcgaag
ctgtcggGGCCCGGGGATACGGGCGTCGA