Description :
From Genome Similarity Track
Location :
scaffold_60:250558- 269896
Transcript NameFunction/comments
g6738.t1 hypothetical protein PHYSODRAFT_472033
g6739.t1 hypothetical protein PHYSODRAFT_552331
g6740.t1hypothetical protein
g6741.t1hypothetical protein

Sequence
19338 bases(100 bases per row)
CTAAAAATATATGATATTGCAACCGCCAACACTTCCAAGCGGCAGCACTCAGGCGTTCCACTCGATGAAGCAGCAACAGCATGGTCAGATTCAGATCCTG
CGCGACAGCGCACCAGTGGTGGATCTGGAGAGAGAGCCTCGCACGAATCGGTCGTGGGCCTGGGTCTGCTCTGCACTTGTTAGCAGAGACAAAGGCGAAT
GCAGCGTGCACGTGGTCGAGACGGTGATCGTGGACAAGCAGCAGATCTGGGCTTGGTACTACACGGACGCGGGTGTCGTACGCCGCAAGCCGCAGAGTAA
ACTCTCGCCGGAGCAAGTGCATCGCGCGTTCTTGCAGTTCGCCGATGAAGTCGCTGGTCAAGTTGCCACGTTGGACGATGCGACCCGACCGGTTGCAGCC
TGTTGGTTTGAGAAGAGCGATACACCCGGTGTCGTACCGTTCCTCGCTGCGCCAGACCTCTTGGTATTTTTGAATTCGCTCGGATCCGGTAGTTCATGCA
CTGCTGCCATCAGCACTTTCGTCCGTCCGCGCGGTGAACTAGACCCGGGCTGCTATGCCAACCTTGAGCATGAATTCACGTAAGTAAGTCTTATTGTTTG
CGTGTTGCTGGTAGTTCTGATGCATTGTGCTTCATTTTATTTCCGCAGCCTCCAGAAGAGCGGTCGTGTGCAGGGTAAACTCTTTTGGTTAGCTCTTGGT
GGGCAGCGAATCGCGAGTAAGGACGTAAAGTTGAACACCACCGTTAACGAGTTGGTACAGCACTTCATAAGCTTCATGGAGAAAAACAAGAAATGCCGCG
TGGCTCGCTGCGTCTCGCTTTTCATCGTTGACGAGGGTGGGAAGCTGCAGTTGTGGCGGACATCGACTTGTGAAACCATTTCTGGCGCAGCGGCTTTGCC
TTCTGCACCAACCTTCCCCGACGCGCTAGGGTCGTCGTTTCCAAGCACTTACGAGGGACCACGTGCCATGAACGAGAGATTACTGGCTCGAGCCCGTGCT
GAAGGCAGGGGTCCTGATGAACGGCTTGTTGAAGCTATCATGGCGACCGCAGCACCTCACCTCAACAGAATTACGTCGCGGTTGCTGCCAGCAGCATCTT
CCAGTACACGTTTGGACCCGCTTGGAGAATCGGAAGGCAGACGTCGAGCAAACCTCCAGCTTCACAGTTCGACGGACTGGGATGAAGCCTTGTCTTTTCT
TCCAGCTACGTCTTCTCTATCTCGAGGGCGACGACGAACAGTGTCGGCAGCTCATCTCATGTCCAGCCAGAAGCGTGGTTGCTGCGGAGACTTTTGCAGC
ATGTCAATCGCCGAGTTGACTGCTCGGCGTTTGGAACGCAAAAAGGAGCCCACGTTAAGCGAGCAAGCAGGCCACGCTAGGAAAGGCCGGCGACGGACTA
GTGTCGCCACCGCCGCGGCTGTTGCAAGTGCCTTCATGGAGTCCCGTCGCACGAACGACTTGCTGTTTCGGTTAGCAGAGCAACGCAAACCATCGTCGCC
ACAGCGACTGCAGCGTGCCGAGACACAGCAGCCTCAGCCACCAACGCACACCATTCCGTTTAAGCTGGTCGCACAGACTCGGGCTGAGAAACAACTTGTA
GATCTCTTCGTTCGACGGTACCAGAGTGGTGAAGATGGCGACTATCTTGCAGAAGCCTACTACGGAGATGGCGAACCTCTCGGAGTCACGTTTCCGGGAT
ACTATTACCGAGACGTCCAGGTCTGCGCCAACTGCTATGAGTTTTACACACTCGTTGAAAAGGTCCGCATGAAGGCTCTGGATCAAATCGCGCGACGTGG
AGAGAAGAAAACTAGTCCAAACCGCCGAAGTCCAGACAAACAGGATGAAAAACGTACTCGAGAGCTTTCGATAGCCGAGCGAAGAGAGGAGACTGACGAC
GATGGCAATAATGATGTGGAGTATTCAGACACTTTGCAGCATGTGTGGAAGCAAGTGTGGGCGCAAACTTCCGTCGTGGCCGCAGCGATCACGAAAAAAG
ACGCCGCTGAGCTGTACAGCTTTGTAAATCCGCATCCTGCTGTTGCGATGGTGTTGAGTGGTCTGGGGGCTTTGCTTCTGGGGTCACGTGGAGGAGACTG
GGGTGAGGTCAAACGGGTGATCTCACAGGATAAACTCCTCTCGCGGTTGCATCGCGTGGATCTAGAGGGACTGTCTGAACGTGCCGTGATGCAGGCAGCA
GCTCATGCTCGTAATCCACTGTTCACACCGGCACAGATCGCGCCTATTAGTTCATGCGCTGCGAAGTTCTGCGATTGGATCCGTACTGTGCTGCAGGCTT
ACGCGTGGAAGCACAGGCTGCATATGCAAGACACGGGGACACGACGTATGCTTTGCCTCCTCAAATCAGAGATCCTGCCAGCCGGCATTGCTGCTGCTCA
GCTGGAAGACGCGCAACGCGAAAATGGGAAAGTCAAGAAGGTCACAAACGATTCAAACAACGATGATTCGTCACCTACAACGCGGCGCCAGTCTCAGCAG
AAGCAAACTGCTCGACGAGCCATACAAGCTCAGAACATGACACGCCTTGCAGCACCGTCGGGGCTACAAGATGGCGTAGGAGGCGGCACTGCAGATCCTG
TATTTACCTGTCAGGATGGAGTCACGCAGATACCGTACGTAATAATTGGCCAGCCCATCGGTCCAACCGTCAAGTGCAATCTCGTAGTGTTTCACGATTT
GTTCGACACGCTCGAAAGCACTCGAGTGTTCTTCCGACCGATTGTGGCGCGGAACGCGGGCTCACGAGCGCTGCTGTTCAATTTCCCAGGTCAAGCCGGC
TCTGCTTATGCAGTCGATGATCAAGCCCGCGAAGAAGACAAGCTTGTCTTGAACAACATGTGGCTTGCGCGCCGTGTGCACGAGCTACTCAATTTCTTGC
AGCACACCGCCCAGTTCGTCACCTCGGGTGCTCCTTTTCACATCGTCGGGTTCGGAAATGGTGCCAACGTAGCCTCGTGCTACGCCGTACTCCATGGCAA
AAGCTACGACGGATACTTGCAGTCACTTGCTCTTTTCAATGGGTTTGCGAGCGTGGATGCTCAGCTAGCCGCGGTGCTGCACAGCGCAGTGAATGTGTTT
GCATGTTTGCCACCGACGCGACCAGACTTGCCAGTGTCATTCTTCTGTAAGTTTCTCTTTTCAGAGGCGTACTTGTGCAAGGTCGACATGAACTTAGCGC
TGAGTATCTACACAGCTGTGACCAACGCCATCACGCTTGACGGGCGTATTCGCTTATGCCGAGGTGCTCTCCGTCACGCAGACCTGGGCTCATTGCTTGC
CGAGATTGACGTTCCACTTGTCCTAGTGCAGTCAGTGGAAAACACACTGGTGTCCCCCACGAACGTAGATCCATTTCTCCAGGGACGCGCAAGTGTGCAG
CATGTATGGTCCCATCAACAACCGCATACCAGTGACCTGCGCTCTAAAACCCGTGCGCAGATGAGGAAAGCACTAGCAACTCCAAAGAGTGCCTTTGTAT
CATGGCTTCGCGCTGGCCATGAGCTCCGCCAGGAAGCAAAGAGCTACGTCACAGAGGTGATCGAGATGCTAGTCAACTCCCAAACGGAGCGTTCAGAACA
AGATCGCCGCGCTACAGAGGAAGCAGACGCGCGCCAAGCAACACCGACGAAGCAGCAAAAGGCAGCAGCAAGAAAGGAGACGACAGTTCCGGATGAGAGC
CAACGTGTCCAGCCGTCACTAACTGATCTCGAGCCTCAAAGTGCTGCAATAACATCCAAAACTCCAGCTGAGCCCTTAGTTGCAGATCCAGCAGGCAATT
CGCTTCTCGTAAGCTGGTCACCACAGCAAACCAACAAATCGCCGTATGACCTTCAACTAGAAAAGTCCGAACGAGCATTTCAGGAGGCACTGCGTACGCA
CGCAGCCCAGAAATCTGCGTACGAGAAGAAGAAGCTCCTGCAACAACCAGGCGCAACGCTGACCACCTCGACAACTGAGATCGCCGAAATCCCAATAACT
CAATCTGTTGTGCCCTTGGACATGCTGCTTCCTCCTGCTCTTCCTGCTATCGTGATGCATGAAAATGATCAAACGTCATGTCCGAACGAAGACAATAGCG
ATACCCAGCTAGATGACGATATCGATGATGTACGTACCAAAATCCGTGCTGAAGAAGTACGACTTGAAAAGGAGGTCGAAGAACAGCGTGAAAAGCATCG
CGCTGCTACTGAGCAACGGATGGCTGCTCTCAGAGAGGAACAGGAGCGGAGGCGACGTGAGTGGGAACAGGAGGATCGCGAGCGACTTGCAGCTCTTGAA
GCACAACTACAGGCTCAACAAGATGAGCGGCTTGCTGAATCTCAGCAGCGGGACCTAGACCAGCTCGCGATGGATGAGGCAGTGCTTGCTGCCGCCAGTA
CAGTCTTAGAAACATCAGTGTCCTCACCATCGCTGATTCTTGAGACGTCTGTCGAAATGCCAATTTCACCAAAACAATCCGCTAGTACGTTGCTGGCTCC
TTCCGTGGAGAAAACACGACAACAGATTCAAGTACAACCAGAACTACCGAGTATGTTTGACCAGCTTGAAGCAGAAGAACACGCTCGGAGACGCCGAGAG
CAGAAACGACGAGCCTTTGGGCCTGGACAGACAGCAGGAAGCCACCTAACCGGCGATCAGTACGACGAGGTACGGACTTCACTAAAGGAGGCCTTCCGAG
AAGATATCCGAGCGAATGAGTCCAACATGAAGCGCGAGTTGCGACGACGGCGTGACGCACAAGCCACACGAGTCCAAAAGTACATCCGCCGGTTCTTGGC
TACGCGTCGAGTTGATCGTATACGACGTGAAACCCAACAAGAGCGCGTCAAAAACTTTGCTGGTGGTGAAGTCGTGAGGATAGCACGGGGCCGCTTAGGC
CGTAGACGATATCGTAGACTGTTTGAAGAGAAGGAAGAGGCTGCAAGGCGATTACATGCAACCATACGCATCCAGACCGTCTTCCGAGGCTTTTCGAATC
GCAAGGCATACCGTGCAAAACTCCGAGAAAATAAGGCGTGCATGTTAGAGCGAGTTTTTCGTGGTCACCTCGGACGGAAGCGTGCCCGGCGACTGCGCAA
AGAGCAAGAACGCCGCCGCTTTCAGGACCGTAACGCTGCCAAAGTGCAGGCTACCTGGCGGATGTACATCGCGCGTGGCAGATTTCTCACTGCTCGGTTC
TCCGAGCTTGCAGCTCTTGAGATTCAGCGGATGTATCGTGGTCTTCTGGGTCGACGAGAAGCTGCACGCAAGAAGCAGTGGCGCGATGCACCGCCTGGAG
CTGAAAGACTGGCGCTCGGACTTCAACTAATTGAAGGCTCGAAGCAGGCTTTTGAACGACAGCAGAGCGAGCTTGATGCGCTTCATCGCGCACAAGAAGC
AGCCGAGCGTCAGGTTAGTGCTGTGCACAACGAGCTGCGTGAAGCCGAAAAGGAGCTGGCTGTGCTGGAGAACGAACTGCAAGAAATCGATCAGCTAGAC
GCCGACGTGAGAGAACTCACACACGAAGCCGAACGACTGCACGCTGGCGGTGTCGAAGGATTGCTACGCAACCACCGATCATCGTTGCAACATCAACCTC
TTGGAAACGGTGTACCGGATACGTCTTCACCACCAGACAGCAACGACCGTGCACCGTACCAGCTTGGGGATGAGAACGCGCTGGAGACGAGGGAGGCCCT
GAAAAAGCGCCAGGCAGACGCGTACGCCGTGGAAATGGCACTCAGCATCAAACGCAGCGAGCGTGAAAAGAAGAAGCGTGACCTGGAAGCGGAGTTTGCT
GGAGCGTTTGCTGAGGTGCAACGAAAGCGAGATGCATTGGCTGCACTGGAAGAGCGGCTTGCTGACATGGAGCAGACTCGCATGCGAAAGGATCGTGAAT
TTGCACGTTTGCAGCGGCATCTGATGGAGTTGCTGGAAGAGCAAAAGCTGGAGCTTGAAAACTTGCGCGAAAGGGGTATTGAGCTCGAGACAGCTACAGC
CACCTCGGCAGCAGCGGCAGCAGCAACGGCAGCTAAAGCTCGCGAGCACGAAGTACGGTCGCAGGCAATGTTTGAATCCACGGAAGAGCTCATGAAGTTC
CAGTTCATGTCGATGTCGTTGTCGTACTTCAGTTCGCTCAATATGCTCAAGAATCTGCGCGACATCAACGCCGACACCACTGCTTCAGCCATCACTTCCA
CAGCGGAGACCGCAGCCACTGCTGCTGCTGCTGCGGCTGCCGCAAACATTACTCCAGTCACCGCAGCTCTCGCGAAGAAGACGCCAGGTGGAGATGCCAT
CAGCAATTTACTAACGACTGTGGCGCAGCGCAAGCAGCAAGAGCTGGTGCAGCGACAACGCGAAGAGGAAGAGGCCTTAGCACCAGGAAAGCAGCAGCCG
TTGCCTGAAGAACTACGCGCGTGGACCGTGGGCGATGTTGGTAGGTGGCTCGACAGTTTGTCATTACCGCAGTACAAGGCTGCGTTCAGCGAAGGCGCAG
TGGACGGCGAGTTCCTCATTGAGCTCCGTGCTGAGGACATGGCTGAAGTTCTCGGCGTCTCGCACAAACTCCATGTGCGCAAACTGCTGACAGCACGCAA
CAAGTTGCTGCCTCTGACGGCGGCGGAGCGGTCTCAACTAGATGCCGTGAACCACGAGGCAAATGCTGCACGTGCACGTGGACAGGAACCGGCAGCAGGA
GATGAAGCCTCGCTGGAGGTGGACACCGTATTCTCGCAGGCGCGCAACGGGCGGATGAAGCGGCTTGTCGAGAGTCTGGACGCAGGCTTCCCTGTCGACA
GCGAGGACGACAAGGGTAACACGCTGCTGCTGCTCGCGTGTCAAAACGTGAACCAGCGCATGGTAGAGCTCCTGGTTACACGCAGAGCCAACTTGAATCA
CCGCAATGCACAGGGCAACACACCACTTCACTTCGCGATGGCCTACGACGGTGAAGGTGTCCTTGGCGAGTACCTGATCGCACACGGCGCCGACGACACC
ATCGAAAACAACAGCGGCCTCACAGCCTACGACGGGCTCACAGCGGAGTAAATGGCGTATCAATCACACAGGACAAGTTGCTAGAGACATTCGTGCCAGC
TCGCATCGTTTGCGAACTCGGGACACTATATTTTTGCTTTCCATTCTGCTGGTGTACCAATGAAGCCTTCCGCAATGCGCACGGCGATTAGATAATACAT
ACTACAGCACTCGCTTCCACAACCGACTTTCTCCCTGCTCCAACAATGCCTTGCAGTGCTCCACGATCGCTTGGCGAGCCCCTTGTTACTTTGATGCTGT
ATTCTCGTAATCTTAGGCGTCCACCCGAGCCTCAGTCACACCACGCACCTGGGAGGCCATCATACGGTTAACGGCGTTGACGTAGGCCGTAGCCGACGCT
ACCAGGATGTCAGTGTTGGCGCCGTGGCCAACGAACTGGCGGTCACGTGTCACACCGGTCTGGGCGTTCACGTGCTTCTCATCTTCCGTCTTCTCCTCCT
CCTCCTTGTCCTCCTGCACTCGCACGGTCACCTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCCACGGAGAAGTCATTCAGCTTGATGCTGTCCAT
GCCCGTAGCGCGCTTGATAGCCACGTAGATGGCGTCAATGGGACCAGTGCCCATGGCAGCCTCGCTCACCTCCTGTCCATCCTTGTGCGCAAGCGTGACC
GTAGCCGTGGGCTTGACAAGGTTGCCAGCCGTCACATGCACGGACTGCAGCGTCCAGAACACCTCGGGCTTGAACAGCTCGTCCGACACAATCGCCTCCA
TGTCAGCATCCGTGACCGTCTTCTTCTCGTCAGCCAGCACTTTGAACTTCTCCACGTAGTGGTCGAGCTCCTCCGGCGTGAGGTTGTTGTAGCCAAGCTG
CTGGAGACGCTTGCTGTACGCGTGGCGGCCCGAGTGCTTGCCGAGCACCATCTTGTTCTCGCTTAGACCCACCGACTCCGGCAGCATGATCTCATACGTG
GCTTGGTGCTTCAACACTCCATCCTGGTGGATACCAGACTCGTGCGCGAAAGCGTTAGCGCCCACAATGGCCTTGTTGGGCTGAATAGACATACCGGTGT
AGTGGCTCACCATACGGCTGCAGCGGGTGATCTGCGTCGAGTCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTAAGAGCCATAACAAGCTC
CTCGAGGGCCGTGTTACCGGCACGCTCACCGATACCATTGATCGTAACCTCAACTTGACGCGCGCCGCCCTGAACAGCAGCCAGCGTGTTGGCCGTGGCC
AAACCCAGGTCGTTATGGCAGTGCGTGGAGAAAATGGCCTTGTCGCTGCCCTCCGTGTTGTCAATCAGGTAGCTGAAGAGCGATCCGTACTCTCCAGGGA
CCGTGTAGCCGACCGTATCGGGGATGTTGAGCGTCGTGGCGCCAGCCTTGATGACCTCAGCAAGAACGTCGCACAGGAAGTCGGGGTCACTGCGACCGGC
GTCCTCGGTGGAGAACTCGACGTCGTCGGTCAAGCTCCGCGCGAACTTGACGGCGTCCACGGCGCGACGGATGCACTCGTCGCGCGAGATTTTGAGCTTG
TACTTGAGGTGGATGTCGGACGTGGCCAGGAACGTGTGGATGCGGTGCTTTGGCGCGTGCTTGACAGCATCGTAGCAGCGCTGGATGTCCTTCTCCATGG
CGCGCGCGAGGCCGCACACGGTCATGGGCTCGCCCGTCGCGCGGTTGGCCGTGAGCGGGCCGACCTCTTTGGCGATGGCCGACACGGCTTCGAAGTCGCC
GGGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCACGCCCAGCACGCTCAGACTGCGCGCGATGTCAAGCTTTTCCTTGAAGTTAAGCGTGGCGCCG
GGCGACTGCTCGCCGTCGCGCAGCGTTGTGTCGAAGATCACGAGGCGCTCCTTGCCGGCCTCGGCGGCGGCCACATTCGAGAAGGCGCGGCTCGCGTTGG
CTCGGGCCGCGGAGGCCGAGCGCTTGGCGATCGACTGCATCATGTTGGTGTGTACGGGAGGAGGTCAATGGGCGGAGCAAAAGTGCACGTCACTGCTGCG
CTGCGGATTGCGGAATGAGCCGCAAAAGTGCAACCAGCCGCTCCGGTTTGAGCAAACACGCGTACAGAGGTTGAGCGGCTGCATCAGCTCCAGGCAATTA
GATGCACCACCAGCAACGGCGCGACCGCGATCTTAGCAGGGCCTTTTGACCAATCGTATTGCGCACAACAGACTTTTGGCCAATGGTAGGGATGCGTAAA
AATGACGTAAAAAGTCATGCGTGGCGTAAAAAAAAAGAGGTAAAAATCTCTTGGCGTGCAGGCCAGTCGCGCTGTCCCGGTGCTCAAGCGCGAGCGGTCA
TACTGTATCATCAGCACTTCACCACAAGAACGTGCGCGAGGCGCCCCAAAAGTTCAATGCCGCGCGCCTCCAACACGATCATCAATATGTTCAATCTGCT
CGGCAGTTTATTCAACCTGCTCGGCAGTTCAACATGAGCGGCGGTCATGCGCGGTTCGACAGATCCCAGCAGCGACTTCAGGGCATGGACAAAATCACCT
TGGACATTAACTCCTGCTTTGCTGCAGTGCCTGCACCTGGTGGCTGCAACGCTATCACATCTCCATACCTTATCAATGGTCTGCTGCGGCTCATGGCCGA
GCACAAGCAGCGAATGAGCTTGTGGCGTCCAATCCGAGGGCCGGTGCAGCCGTCCTTTCCTTGAGGTCTCATCAGATGTTCACCTTCAACCTGGCCTTGA
ACTCAAACAGCGCGTCAAGGTGGCAGTGCTTGCAGTGGCTCTCAGCCCAGTGAGCTGAGCTCACATGGAAGGACGGCTCGCATCGGAGCACCAGACTGCG
GTGCTGAGGCTCCGATCGAACGTCTTTGATGTAGATGTACCGTCAAGGTGGTACCGGAGACGACTCTTCATTGGCTGATTATCGCATTGACCGTTACGCC
GCAGTGCGCCATGTCCTCGCCAAAAGCATAATCGTCGTGGAGCCCGTGGTCTTGGAGACCAGTTCCGCTCCGGATGGCGTCTCGGCCGCTCGAAATGCCC
TCGGGGCGCATCGCCGCCCGCCCCCCAATGCGGCAGAACGTGGCTCTGCGTTGGGTGAACGCGGTTGTGCCAGCTTCGGCCGCATCCAAGACCTCGCCTT
CGCCCATAAAGAGATGGCCTCCCCCGTCGAATGTTGAAGCCCCGCCTCATGCTCCAGTGATTGCAACATCGATGCCAGCGCCTGCAGTGGAGAAGAAGAA
GCCGGTGTCTGCGGGATTTCAGTCTGCGCGCGCCGTGTTCGAAGCCAAGAGAACTACAACTAACCCGCCGCCAACTCGTCGCCGATTGCCGTTCCCCGCC
CCACCTGCGCCTGCAGTTGTGAAACAGCACTCGGTAGCATCGGATTTGTCCAGCTCTTCATGCAGCACGGTAGACTCCGAGAGCAGCCGCATACTGGAAG
AAACCATGGAAGCGCAGCATGAATTCATGACACGGTCGCCGGTTCGGCCAAGCGAGGCAAAAAAAGTGGAAAAGAAGTCCTTGACGATCACCTCTTCTGT
TACCGCAGCAGGCCCTGTACCGCGATCACCGCTTCCAATTAAACAAGCCGCTAGCTCTCACATACCTGCATTGCTGATGACAACATCCGCGCAGGCGAAG
CAAGGACAGCCCAGTATTAATGCCACCATTGATCCATTCCAACTTCTTCTTCCAGTTGGAGCGGTACCAACACTTCCCGATGAAGTGTCATGCGTCTATG
ACAACGCTGCGATTGAAATGCAGAAGGGCGTCAAGAAAGTAGTGCGCAAGCTGCTCAAGAAAAACAAGGCACGGCAAGAGGAGTTCAAGGTCAATTCCCG
GCTCTTTGGAACCGATTTCATGGACTCGCAAGCTTATCTGGACACGCTGATCAAGGACTTTGGCGCAATTCGTGCCCTGCAACTTGTTCCGTGCTTGTTG
AGCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATCTATTGCGAAACGAAGAGTCATTGGAGTGTGAGCTGCGGGCCT
TGACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTCTGTGGCCATCCCGCTCCCAGACGCTGAGGTGAAGACTCTATC
GCCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAGTCGAGAGAAGAGGTCAACTCCACGGCTACAGTCTGCACCTCT
ATGTCTGACCATGTCGATACTGTCGATACTGCTGCCGGCAAGAACGATTCTGCAGTGTTGCCAATTTCGGCTTCTAAAGATATAGTTTCGGCTACCATTT
TGGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCACTATCCAGTTGGCTGAACCCATGCCAGAACCTCAAGAGGCAGC
ACTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCGACGACTACAGCGGTGCGCGGGATTGATGCCAATCCAGTTATC
AAGAAGAACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAATCTCTTCGGCGAGCCTATCAATCCTACTTCTCCGCAGCAAC
AGCAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAGAGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCTCGCTCCAG
CACGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTACAGCGAGCCTCATGCATCAACAAGAAGCCCGCCCCGCTTATT
TTCGGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGAAAATGAAACATACTCAAGTGTAAAGCATTGTGTCGTTTTG
CCTTGTCGAGGCAACCGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGCACACAGGTTGAGGTTCACAATCCCTCGACAAGCAAGATG
TCTTCGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACTTCCGGGTGGAAGTGCTGGGCAGCCAGGAGTCTCTGGACC
TGGACTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCCCAGTCTCACCTTGTACGGCTGCAGGAATACATCCTGCG
CTGCTCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAGCAACTTCATTTGCATGGCATTGAAAACAGGAGACTGAATTGGGCGACGCTGGT
GCACAGATTTGGGACGTCGTGCGACGGTACCGCGAATTTTGCGCAGTCGACATTTTGGTGAGAAACAAGGAGCAGTCCACGCATTCGTCACGTTATACGG
CTAACAATGTATGCAATACCTATTGTGTGTATTTGCAGCTGCGCGAAAAGTATCCGTCGCGGGCGCCCATGTTCCCGTATCTGCCGAGCAAGAAGTACAT
CGGGTCGTCCCTGTCGGCCGACTTTGTGGACAAGCGGCAGCGCGACCTCGGCTACTACATGATGTCCATCCTGCACAGCTGCCCGCTGGTACGCACGTGC
TGAATTCTATACGCCTGATGCTCTTATTACCCGCCTATTGACACGACTTGGTGTTGGTAGCTCGTTCAAGACGAGATCATTGACTCGTTCCTGGACATTA
AGCGGCACATTTTGGAGCGCGCGCGGGAGGAGTTTAACGACAGCCGCTTGGCTTCTACCCCCACGCACACGACGAGCAGCAACGGCGGCATGAGCCCTGC
ACGGCTGCAGCTCTAGTTCCATCAATTCAAATACACTTATTACTTTTGACCAGATCAAGTCTCGTCCCCTCGCTCAAACAGCAATTTGCCGAGAGAAGGA
AACGAGTATACAAAGCCCCATACAAACCATAACCCCCTCTTTAATCCGATATGGACCATCACTCTGCGCAAGATTTAGTGGCTGCACGCACAGCAGAGCG
AGCTCCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTTGGAGCGTGTTCGTTACCAGTCCCCGCGCGAGTGTACGAGCGCTTCCAGTGGACGAGAG
CACAGCCGCGTCAGGGGAAAAGGGGGAGAACATGGCGCTCGCAGACATCATGTCGGTGGAGATGAGTGCCAAATACATGGACTCTAGCAGCTCATCGAGT
CTGTCGTCGGACTCGGACGACGTGTTGTCGTCCTCGAGCTCTTCGGCCGTCTCGTCGTCGAACTCGGAGTCGGACTCGGACGCGCCGCGAGCGTCGGCCA
AGAAGAAGAAAGCAGCAGGTCCTCGAGGACGCGCTGGGAAGAAGGTGGACGTGGCGCTCTCGGACTATGAGGACGACTCGGACTTGGACAGTGCCACTAG
TGGAGGCAGCAAGAGGAGGAAGAAGAAGAAACCTGCAGCACCCAGACGGTCGCCGGTCAAGAGCAACGGGAAAGCCAAGAAGGCGGAGAAAGCGGCTCCT
GTAGTAGCGGCGCCGCCGAGTCTTCCACCCCCTCCTCCGCCTCCGTCGCCTCCTCCGGCTGCACCAGATGAGGAATCTTCCAGTAACAGCTCATTCAGCT
CCAGTTCCAGCTCGGACTCGTCGGAACTGTCGGACTCGGAGACAGCGCTCCCCGTTCCCCCGCCACTCCCACCTGCGGCTGGTGACGCTTCTCCTGCAGT
GTCTGCGGCTGCGAGACCGCCGAAGCGGAGAGCTTCGACCAAAAAGAAGGCGGAAGTGAGTCCGTCGTCGCTGAAGGTGACGCTGAAGCTCCCGCCAGGC
TTTATTGCAAAAGGCGGGGGAGCACCTGCAGCTAGTAGTCGAGCTCAGGTGAACGCCCAGGCGACAGACACGATACCTAAACGACCACGAACGCCCACAG
CTACAGCAAAGGCTGCAACAAGTTTGCGGTCTGCCAAGAAGAAACAGCCAGCAGGTCGTGCCCAGAATTCTGTTGTCCAAGCGAATGGGACGTCCCCCGC
AGTACCGCTCGTTCCGGTTAGTCCTCCCGTTTTGCCCAAGCTGATCCCCACTGGTCCGACGGTCCCTTCAGGCGAGGTCCGAGGTGCGAAAGAGCTCTCG
CTTGTGGACCCGGCCCTTGCCAGAGACAGACCCGAAGAAATTATTGAGTCGAATATCCCGGCACACTTCAACGACGCTTACGCTCATGGAGGCGATACGC
TGCGCCTTTTGGACATGTTCTTTTTCTGCGATGAAAACGGGTATGGCGAAGCCTCACTCTTTGTTGGATGGAAGATGAATTCTAATATCGTTGTTTTCCT
CGTGCCGCTTGTTTCTACAGCAAGGCTATTAGTCTCGAGATTTTAGACCGACCAAAAGATCAGCGCCCGAAAATCATGGGGTTTGGAACACTCGTAGAGC
ATTTGCCACTAGCGGAGCGTCCGCTTCCAATTCGGCCTATTCTTGCGTCCCCAGCATTTCCCTCGCGCTCCAAGAAACGCCCACGCGCGGATTCCGCCTC
GTCGACCCCTGCAAAATCCCCATCCGCTAAAGCAAGAGCGAGGCCCAACAGAGGTAAACTGTCGTTGTTGCTGCTGTGTGTCGAACTGGTAATGCGGTTT
TGCTTATTGTTTGCCATGTCCTAGCAGGAGCCAAACAAAATGACAGCAAACGCCCAAAAATTGAGGATGAAGCCATTTATCAAGGCGATGGTGAATTCGA
AGACAAGAAGAGAGAGGTTGCTCATGCAGCAGATTCCTGCATTTTCCAACGGTCGACCGTCTATCGCTTTCCTAGCCCGTTTTACCCGAATCAATTGTCT
CAAATGGATGGACAATCCGATTCGGATAGTGGTGGTAGCGATTTGACTTCAGACGACGAGGATATTCGTTCTGGCCGAAGTGGATCTGGAGCTGGCTCCG
AGAACGACAGTGAGCTCCTCTCGTCCGCCACCAGCAGTTCGAGTGGTAGCGGTAGCGACAACGAAGTAAACTCGGGCAATTCTTCGTCATCATCCACTGG
TAGTGGTGCTGAGAGCGGAAATGGTACGACGACAGCGAGTCGGCGCTCGTCGGCTACTACCGGCAACCCGGCGGTCATTAAGGCCGACCACTTTCCACAA
CGAATTGCTGAACCAGCAAGACCTCCAATTAACAAAGTGCAGAGGCGACCGAGCACCAGCGTGGATTCCAGAAACGCGGGCTTGCCGGCTGATGTAGTCG
GACTTATGCGAACTGACCAAGCCGTTGACGTCAATGCAAAGGGCACTCCAGATGAGCTTAATTTGATGGAGTGCGGTTTCAGACACCCGTCTAGCTACGC
TCGCACTCGCGTTTGGCTTCCTGAGATCACGGATTGGTGCCTGGACTACGCTGAGGGGGACCCAACACTGTGGGTTGTCACGCCTCATTCCTGGTACAAG
ATTGCAGGCCCGCTGTCTGGACTGCTACCTCACTCATCGTACCGTCATACTTTCAAGCATGTTCGTCATCTCTTTGAGGCAAGCTACCTTGTGGCGTACG
TTCTAAAAGAATGGCTGCCGATTAACAAGAAAGTGTCCTATCGAGCCACTCTCCAGCAGATTATTGAGCTGTCTTTAAAGGGCAGATTTCGAGTGGTACG
ACTGCATACTGCATTATGTTGGTGGTGTGAGGATCATGACTTATCGTTGTCTAACGTTGGTGTTGTTGAATAACACGTGTGTTTGTAGTCTGCGTGGTTT
CTTGTGAAGAATTACCCGTTCATTCGAGCCCAGATTTCAAATTTGTTTCCAGACAAGGAAGTGTATCTGGAGTCAATGTTCTTTAAACAGCTGCATCGCC
TGCACGAAAACTACACGCTACGTGAGGCAAGACACCAAAAGGAGATGGCCGAACGAGAGGTTCGACGTGAGAAGCGAGAAAACGAACGCCTTCGGAAGAG
ACAGCGAGTTGATGATGCGAGGCAGCGCATGATGGACGAGCGTGAAGAAGAACGAAAACTGAAAGAGCACGGTCAAAAATACCCTGTCGAAGATTTGCGA
CTGCTTGAAGGAGATGCAGTCAACACCAACAGCCTCCCTTTGGCGTGCTCGAGTCTAAAGGGAGTTGAGGGCCCTCTTCTCGGTGAGCTCATCATGGCGT
GGCAAACGATCAGCACTTTCAAGGATTTTGTGGGGCTTGAATCGATTTCGTTGGAGGCACTTGTGGAGTGCATTACGACTAGTTGCGACGAAGGCACCCA
TGTGGGATTAGCGCGGATTTTTATGGCGTTCCTCCATGTCATCTTGTCGGAAAAGTCGTTTATGTCGCTGCTGGATGATCTTGTTGTTGAAGGTAATATC
AAGGTCTCAGACCTGTTCGTGAACAGTGAAAGGACTTACGGAATTTGCGAGCGTGCCTACGGTGACATGTTGAATGCTGTCACTTGGCAAGAGATTCTCC
GTCAATTGATGTCCAAGGACATGGGAATCGACCCATCTATTGGCCACGCAGAGCCTTTAGTTGGGTGTGAAATCGTCCGGCAGACGCTATACATGCAAAC
CAACTCGACACCATTCAATACTCCTGTTGACACATCCGCCAAGGGCCTAGAGGATTACTTGCAGATCATCAAACACCCAATGGACCTGGGGACTATCAAG
AAGCGAATTGATTCAGGGGGATATGAGGGGTCCGACGGTTACGAAAAGTTCGCGGGGGATATTAGACTGGTGTGGGATAATGCTGTACTGTACAATGGCG
AGGAGTCAGAAGTAGGGCGCACTGCCTTAGCATTGTCGGACGTCTTCGAACAAGATTACGAGCGTTTCGTGATCGGACGTGTTCGTGCAAACCAAAGCAG
GATGGAAGCGTGCAAGAAGGCTAAAGAAACGCTGCAAGACTCATCAGCAGAGAAGGTCAAGACGTTCAAGTATGCCGACGTTGTGTACGGCCTCTATTGC
TTCGAGTTCCACGAACTTCCGACGCCGTACAAAATTGGTGCTCTTTCGTGGATTTGTTCAGAATTCTTGACCCTTTCTAGCATTCGAACCTACATGGCAT
CTCAAGTGGATCAGGAGATGCTGATTCACAGGAATCATAGAAAGCGCGCAGCCGATTTGGACTCACAGAGAAAGCACTCCGACAAGATGCGGCGTGAAAG
AGAGAATGCCTTTAGAAGAGATTGTGCTAACCAAGGCATCCATCCCAATTCGCACAACGTTTTCTCGGAGGGTATTAAACGCAGGCACGAATTTATCGGC
AAATTTTTCGAAGACATTCAAGCAGAGAAAGCTGAGGACGATAAAAACGTGGAGCAAGAGAAGAAAGTTCAAGCAGAAGAAATGGCGAGCGAACTAAGCT
CAATTGTTATTCGTGAGGCCCCCCTAGGGAGATACAGATACCACAATTCGTACTATATGTTCAAGCATGATACGAAGCCGCGGTTGTTCATCGAGCGCGG
GGATTCTGGAGAGTTCGTGGTTTGTGCCAGCAAAGCTCAGCTTACGACAATTCTGGAGTGGTTAAACCCTAAAGGAGTTCGGGAGCTGGACTTGTTGACG
AAACTACACGAGGTGAATGATAAGCTACTTAGTGCCTTCGATGAAGAAGAAGGCAAGCAAGACGGAGATACCACCACGGAGTTGGTATGGAATGCTAAGG
ATGGTATTGAACTCCAAATGTTCCCTCTTCCGGGTGGCGCTATCAAGAGTGAGACAATGACTATTACAGACGCGGACAAGGTCATCAAGTCACACAACGT
GACCCGCAAAATGTTACTTAGTTTGAAGCAGCATTTAGAGAGCACAAACACGCTGCCTGCTTCTTGGGAAGGTTCTGAGACGTGGAGTGATCGTGTGGAA
GAGGCAAAGGTATTCAAAGAGCAACTCGATCTGTTTGCAAAGCTGGAAAATGCTGCAGTGACAGCCCTGAATTCAGGCGTGGAGACAATCAGACCTTCAT
GGCAGCGGAAGCGACATGAGTGGCGGTTGGCACTCGAGGGTTCATGTACATACGCGCAGTTAGTGTTTCTACTGCATCTGCTGTTGGAGGAGTTCATTAA
TGTGGAGGCTTTCATGGATCTGCACATCCGACTTGATCGGCGTGAATGGCTTAAGCTTCGACCTAAGGAGACTCGGAACTTTATTCCTGAGTCTGGAAAT
GTTGTCGTATACTTCGGAGATGGCCATGCCCTGGCGCTAAAAGAAGACGAGAAGAGCAAGAAAAAGCGCTTCACACAGAAAAGTGATACTCCTGTTCGAA
ATGCAGCAGTTGTCTGCACGGTGGAGAAGGTATCTTACCACCACGGCGGAGGTGACCCGTATGCGTTGGCGGTATTAAAACCTGTCTCGGACATGGCTCT
GCACGAATGCATTCGTAAGCCTGGAGAGCTCTTGTGCCCCCTGCCATCGCGAGAACAAAGGCTTGCGAGAGTGTTTCTGCGAGTTTTGGCTAAGCTGAAA
ATGCTAGCTGACGCCGGACCGTTCCTTGAGCCTGTGTCTGATCGGGAGTTTCCACAATACAAGGAAATTATTCCTCAGCCGATGGATCTTGAAAAAATAA
CCTCCAAGGCAAGCAAGCTGGAGTACAAGAATGCGGTTGAGTTCATGACTGACCTGAGGCTCATGCGCGATAATTGCCAGCTCTTTTGCGAAGGCCGCTT
TCCGACACTGCCGCCGTTGGCCCACAACTTGGTAAACGTTGCGGATGGACAAATCAAAAAGTGGGGTAAGGAAATTCGTGCGTGCGAAGATAACTTTGAT
GGCTCGTCATCGATGAAGAATAGCAGCACGCTGTCTCCGGAAAAGAAGGACGCTATCAAGCAAGATGAATTAGACGGAGGAAAGACGGAGTTGCCAGCCC
GTTCGATCATGGCAATTTTGCGCCTCGAAAATCGATTGCCCGAGTACATTGTGGATATTAGTCGTTACGCGTGGGCGGTGAACCGTACATGGCATTGTGG
AGAACACTTTCGTATGCTGTTCCGCAACCCACAAGGGTACCCAGGCGAGTACTACGGAGGGGTAACCGCAGGGTCCTTGCCATTTGATGATCACGGAATG
CTGCCATGGGAGGCGCTGCGTATTACATGGGACGAAGATGACGGGTCGGACGACAATCGCATTAACCCATGGTTCGTAACTTGGCTGGTGTACAGGATGC
GATGTTTGTCTGATTTCTCACATTATTTAAACTTGTCTGACGAACAGGGAAGCGGAGTTTCCTCGGGGTGGAAATCGGGCGTAGATAGAGATAGATGTTC
CAAGCTCTCGATTTCGCTTAGGCTGATTAAAGTGCTCA