Description :
From Genome Similarity Track
Location :
Scaffold_77:250550- 253838
Transcript NameFunction/comments
Hyaar_Emoy2808282hypothetical protein

Sequence
3288 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACTGGTGATAAGGTCTAAGGCGACCGACGTAGAATGTAGGATGCGTGCGCATCTTACGTGGCAGTTCGATCGTGTATGCGT
TGCCTATGCGGCGCAGCACACGAAATGGACCGATGAACTTGGATAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGA
TAGTAGGATTAGGTCACCTTCGTTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCATCAATGGAATCT
TGCACGAAACGGACAACCGTTTCGCGAGCCAGCATGAATTCATCTTCTGACTCGCTGTTTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAAGATCAG
TGACCTGGGTAGTAAGAGCATCCTCGCTCTTACCTTTCTCTTCTTCACCGAAGTCGATGTGATCGACATGGGCGTCATACGTAGTGACCTCGTGGTCAGT
ACGTAATGAGCGAGAGCCGACTTGGCGTTCGCTCGAATGAGTCCCTTCCCCCCCTCAAACTAGAGTTACACTCTAAGAAGTTGGATAGGCGTGGGTGGCG
CAAGCCATTCACGAAGAACGGTGTATGCGTCATCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAAC
GAATGGACATAACCCCGAAGGATTTCCTCAAGAACGCGGTTTTGCACGTTCTGTCTGACCATCTGTTTCAGGATGGTCAAAGGTCGACATCTGAAGGCGC
GTTCCGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGGATCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCG
TGTCAATAAAAACACGAGCACATGCCGATGCGTTGATAGATTCAGGCACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACC
TGTATTCTTGTGTGGGTCTGCTGGGAATCTAAAGGCAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGA
AGTGAAGGACCTGCCTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGAATAACTG
TGAGATATGTCTTCTCTCGACCACGATGGCCACCAGTAGGTGCATCGTGGCACTCATACATGATGCGCAGTCGCAGGTCACCATGGTCCGGTACGACGAC
ACGAAGTGTGTCGCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTTTATATCTATCCGTGGAGGATCAATATACTGGGGTCAAACTTTGAAGG
GATTGACGGGATGGTTGCGAGAGATGTTCCATCAAACGCACCATCGACGGATCGTACGCCTTGCGTATGTCTTCTAGTAAGATTGACGACGGGGTACTCG
ACGTCAACACCGCGACAGTGGTCGGACTAGTGTCGGGTTGCGCAGCCGGTTCGAAATAGGGCCGGCGCGAAAGAGCATCAGCGACGACATTCAGTCGTCC
TGGTTTATATTCCACGGAGAAGTTATACTCTGCGAAGGACGACAGCCATTTCGCCATTCGTCGCGAGAGGTGTGGACTGTTAACGGCCGTGCGAAAGGAA
GCATGGTCCGTGTAAACGATAAATTCAGGGTCTATCACCTAGTAGGTAGACCCTGAATTTTGCCAAAGCATAATTTATGGCAAGTAGTTTCTTGTCATGG
ACTAAGTAGTTACGTTCAGCTGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGG
CAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGCCTTGGTCTGCAATCGCCAAAACTGGCAATCGTATCAAGCTTTGCTTGATATCTTCGAATGA
GCGCTGACAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTTAATAAACGAGAGAGATGAACAGTAATCTCGGCGTAATTGTGCGAGTATTTAGGCAAA
TACGCCGCTAGGCCAAGGAACTTTCGAAGTCCTTTTATATCGGTAGGCAACGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCTGACGCCGTG
CTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACAATTCTTGAGGTTGGCATACAACTTGTGCTCACGCATTAGTGTAAGAACC
GTTCGGACGTGGTGTCGGTGGACTTCCAAATCCGTCTGTCCATCCATAGCCCGGCTATGGACGAACACGTCATCGAAATAGCTGGGTGCGAACTCTCGCA
ATGATCTCAACAGATTCGTAACACATCTGTTGAACGTGGCAGGGACATTACTCAGTCCTTGTGGAATTACTAGCCACTCCCAAAGCATACCGCTTGGGGT
GCTCACTTCTGTACAAGGAATGTCCTTTTCGCGCATAAGGATCTGATAGAACCCGTCCATCAGATCCATGGACGAAAAGATGGTACTCCTTGACATACCA
TCTATAATGACATCCTTCCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCT
ATCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCTCATGACCCGCTGCCAAGCGATCGCCAAAGAATTTGTCAATCGCTAGTACTTG
TTCACGAGGCAATGGCCATTGCTTCATGACACAGTAATTTGACCCTGGTTTCAGGTCTATCTCGTGACGAGTACCCTTATCCTTAAGTAGCTCGCACGGC
ACTGTTTCTGGGAACACATCCCTGAGTTCTATCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTGTATCGCTCAATCCGAG
TCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTCCGTTCTCAGCGAATACCATTTCCGACCGAATATTGGTTACATACTTGTC
TTCCGCGACGAGTACGCAAATCTGCTTGATTTTGTCACTATGCAGATCACGTAAGGAACTTTTTCTGTTCGAGCGTGGGAAATTGAATGATCTCCGAAGT
TGTCTTCGGAGGCGCGATCAGATCAAGTTGGTATGTTCCTATGCTTGATCCGTCATTGACTAGGATATTTAATGTCTCTGTTGTCTCC