Description :
From Genome Similarity Track
Location :
Scaffold_248:25054- 31785
Transcript NameFunction/comments
Phymu_g7495glycosyltransferase

Sequence
6731 bases(100 bases per row)
CGGCGGCAAGATGGATCGGCGCCGCGCCGGCTCCAACTACTTCCAGCTGGACGCAGACCGCAAGCGCAACACGTCCAACAACCGCAGCAACTACGGGGAT
GGTCGTGGCACCTTCGGCGATCGGCTCAGCATGATGGACGTGCTGCCTCCCAACACGCAGGGAGGCAACCAGATGCGCGGCGGAGGCCTGCAGGGCGACT
TTGCGGACGAAGTATCGGTCGATTTCTGCTGCGAAGTGCTCTACAACAAGTTCGGCTTCCAGTCCGGCAGTGTGGACAACCAGAGAgagcacgtgctgct
gctgctggctaATTCCAAGGCTCGAGCCAAGCCCCAGGACCCGCCTGGACACCACGTCGTTACGTtgcacaagaagctcatgagCAACTACACTGAATGG
TGCCAGTTCATTGGTGTGCCGAGCGTCACGTACTCGGGACAACCGCAGGGAGACCTCAAGAACCCGCTGCACATGGATATCATgctctttttgctgcttt
ggGGAGAATCTGGCAACTTGAGGCACATGCCCGAATGCCTGTGCTACATTTATCACCAGGCGCTGAACATGCTCAACCAGGACTTCCTTGGACAGCAAAA
GGTGCCTGAAGGATGGTACTTGCGGCAGGTGGTGCGTCCGATCTGGAAGGAAGCCTCGAACAtgcagaggaagaacagTCTCGGCAAAAACTTGGAGCAC
ACGCAAGTGCGCAACTACGATGATATTAATGAGTACTTCTGGAAAAAGTATTGTATTAATATCGACATCACGCACATCGGAGAGGAGCTGACCAAGAAAC
ACACCAAGACCTACTACGAACACCGTAGTATCTTTACGCTCGTGCTGAACTACTACCGCATTTTCCAGTTCAACATGATGTTCATGATGGTGCTCATGGC
CATCGCATTCATCTCCGCCATCTCGCCTAGTGGCGGACAGCAGTGGTTCGCTCAGTTCGGTTCAATGGGAGAAGTCGTGGAGCCctatcagcagcaggac
gtcAAGCTCACCTACGTGGCTATTGTGTTCGCTCTCTCGTCGATGGGATTCTGCAAAACTGTGCTGGAAGCCTGCCACGGTTGGCACTTGCTCACCGCTA
GTGAGTCGTCCGAGACGTCCTCACGTTCGTTCAACTACGGTGGTGCTCTTGTGCTTCGTATGCTCTGGAATGGTGCATTTGCCGGAATCTTTGGTTTGAT
GATCTACACACCGCTGATTACGAGTGAGAATACTGAGCTACTCGACAAGGCTGCCCCGGCCTCTGTTGCCTATATTCTGCCAGGCGCACTGATCATTGTC
GTGCAAGCATTTTCCCCGAAGATGATTACAAAAACGTTTGCGGCCAAGTTCATCCGTGAGGGTGAGACGTGTTATGTGGGCCGCAACATGGCTCCTCCGT
TGAGCTACCAGATGAAGTACATCACCTATTGGGTGATTCTTTGGTCTCTGAAGGCATTCATCTCCTACTTCATTTTGGTGCGCCCATTGGTTCTCCCGTC
GCTTGCCATCTACgaaatggagctggagtaCGGAAGCAACGTCGTGTCGTTCCACAACTTCGGTGTGATCGCGGCGCTGTGGCTGCCTGTGATTTTTATT
TTCAACTACGACACCCAGATTTACTTTACCGTGTTCCAGGCTACGCTTGGAGGTATTCAGGGTCTCATCATGAAGACCGGCGAAATCCATGGCATTAAGG
AGATTACCAAGGCCTTCCGTGTAGCACCCCAGCTGTTCGATCAGAAGGTGGTAACCAACCTAGCTCGCTCGAACGATGCTGCCGCTGATGGTTCCGCTGC
AGCATATCAGTCTCAAATGATGCTGCGTTTCGTGGTCGTCTGGAATGAGATTGTAAACTCGTTCCGCGAGGGTGATCTGGTAGACGACAAGGAAGCTGCT
ATCTTGCAGTACGACATTCAGAGCTCAGGCGACGTTTTCGAGCCCGTGTTCCTGTCTGCTGGTAAGTTGgtggaagctctcgagtACACGgtgaagctgg
ccaaggaAGGAAAAGGCGATTCGCAGCTTCAAGTGTACATGGTGCAGAAGGATTGTTTGTCAGCTGTTCGCAGTTTCTTCACTGCGAGCATGTATGTGAT
GGAAGCTCTGCTCGGAAGTGATGACGCCGACATTCTCGACGCGCTTCGTCAAATGGAGACGATTGCTGCTAACGGTAGCTTCATGAGTACTTTCGATGCA
AAGAGCCTCGTACAATTGCGCACTGTATCgatggagttcttggagGCTGTGATGGACTTGCCTGACCCGGATGCCCAGTCATCACACCTAACGACGTCAC
GCGTGCACACCATGGGTGTTGTGCGTAACTTCGTGACTAAGATGGAGAACCTGCTCAACGCCGTTCGCATTTTCGCGAACCGCCCTGAACTTGCTGCCAA
GTTCAGCAACTCCAAGTTTTGCTCTAGTGCAAATGGATACGTCTTTGCTGCTCGTGGTTTAGTGAACCTGTTCCACAACGACACGGCTATGGGTGCCGCT
ACGCGCGCGTATTTGCTGATGTCGCTTGAAAAGGCTGATGCTATGCCCCGCGTGCCTGAGGCCCAGCGGCGTCTTGGTTTCTTTATGAAGTCACTTGTGA
TGGACATTCCGCAGCTGACGTCGGTCAAGGAAATGCACTCGTTTTCCGTTGTGACGCCGTTCTACAGTGAAAGCGTCCTGATCTCTCTTGCGGAGCTGAA
CGACCCACTGGTGAACCACCCCGTCTTccagaaggtggaggagaagggcaagaatATCACTATTCTGAAGTACCTGATCACGATCCACCCTGAGGAGTGG
GAGAACTTCTTGGAGCGTATTGATGTGAGCACTGCCGAAGAAGCACAGGCGAACTACCCCCTGGAAATTCGTCTATGGGCTTCGTACCGTGGTCAGACGT
TGGCTCGTACTGTTCAGGGTATGATGCTCTATGAAGATGCTATTAAGATTCTGCACTGGTTGGAAATTGGTTCGAGTCCCGGCAAGACTgccgagcagaa
gcaggcCCAGCTTGAGGACATGGTGCGTCTGAAATTCTCGTACATTTGTGCTTGTCAGGTGTACGGAAAGCATCGTGCAGAAAACAAGCCCCAAGCCGAT
GATATCGACTACCTGCTGAAGACGTACCCGAACTTACGTGTTGCCTACGTCGACACCATCGCGAGTGACGGTGGCAAGCAGTTTGATACTGTGCTTATCA
AGAGTGAAGGCAACGAGATTGCCGAAGTATACCGTTATGAACTGCCTGGTGACCCGATTCTTGGTGAAGGTAAACCGGAGAACCAGAACAATGCACTTCC
GTTTACGCGTGGTGAATACCTGCAGACGATTGACatgaaccagcagcactacTTCGAGGAGTGTCTGAAGATGCCACAGCTTCTCGTGACCGCAGACTTG
CACCCTTCGAAGAAACCTGTCTCGATTATTGGTATGCGTGAGCATATTTTCACGGGCAACGCCTCGTCTCTGTCGAAATTTAAATCGTGGCAGGAGCTTG
TGTTCGTGACGCTGTCTCAACGTGTGCTGGCCGATCCACTGTACGTGCGTATGCACTACGGTCACCCTGATATTTTCGACAAGATCATTGCCATGCCTCG
TGGTGGTGTGTCCAAGGCTTCTAAGGGCATTAACTTGTCTGAGGATGTGTTTGCAGGGTTCAACTCTACCCTTCGTGGCGGTGTGGTGACGCACGTGGAG
TTTATGCAGTGTGGTAAGGGTCGTGATGTCGCTCTTTCACAGATTTCCATGTTCGAAGGTAAGCTGGCAAACGGTGCCGGTGAAACCTCCCTGGCACGCG
AGGCTCACCGCATGGGCCAGTTCATGGACTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGGTTCTATTTCGCTACCTGGATGACTATTGTGAC
AACTttcgtgtacatgtactgcaagGTGTACCTGGCCCTGGCTGGtgttcagcagcaaattgTTTACGACATGAACTCGACTGCTGTCATCACTGACAAC
ATTGCCAACAACTTTGACGAGCGTGTATTCACGGACTTGAAGGCTGTGCTGAACACACAGTTCTACATCCAAGCCGGTATGTTTCTGATGCTTCCGCTGA
TGTGTGTGTACTTCGGTGAAGGTGGTTTTGTGCGCGGTGTGACGCGTTTCGTCGATATGATTATCACGCTTGGCCctgccttcttcgtgttcCAGGTCGG
TACGACGATGCACTACTTCGATAACAATATTGTGCACGGTGGCGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGATTTCACGTGAAACACTCGTACTG
CTGTACAAGGCATACGCAAGTTCGCACTATCGAAAGGCTTGGGAGCTGATGGGTTTGTGTCTGGTGTATCTGGTGTTTGGCAACTTTTACATTTGTCAGA
CCGATGCCTCAGCCAACGACAACACCTTTGCGTCCGACTACTGTGACACTTCTCAGGCTTACGGTGTGCAGACGTTCTCTGTGTGGTTCATTTCGATTCT
GTGGGTGGTTGGTCCCTTCATGTTCAACAGTGACGGTCTTGATCTCAGAAAAACGAAGGTGGATATCCAGCAATGGTGCATGTGGATGTTTGCCCCGGAA
GATTACAAGGATGACGATCCGGCCAACAAGGGTGGCTGGGTTGGCTGGTGGAAGGGAGacctcgagcagcttcacaaCTCGAACATGATTTCGCGCGTTA
CAGTTATCCTTCGCGAGTGCCGTCACTTCCTACTTATGTTTTATGTGGCCACTCTGGAGACGTCTGATGTTATGTACGTTGCGTACTCGTTCGGCGCAGC
TGTGGCGACGATTATCCTTCTCGGGTTTTTCCACGGTATTGGTATGGGTATGCGCTCCATGAGCCCCGTGTCTCGCGCTGTGATCTACTTTGGCACTATT
GCGGTCTTGGTGACGGCATACTTCCTCGCTACATGGATCGTGATGGACTGGACTTTTAAGTACTCGATCTCACTGTTTTTCGCTTACGTGGCTGCTCTGT
ATGGTATCAACGAGTGTTTCCGCATGTGGAGCTTCCCGCACTCTTCCATCGCTGGTATCGTGgtgttccagcagctgcaatTCCTgttcgacttcatctt
ctgTACGGGTATGATTATCCCGCTGGTGATTTTGTCGTGCATCCCTTTCCTGAACGTTATCCAGACGCGTATGATGTACAACGAAGGTTTCTCGAAGGTC
ATGTCGGCTTCGTCGCAGTACGCGTTTTCGCTTGCTGCCTTCATGGGCGTTCTCGGTGGTATTGGAGTTGGTTGGCTGTTTAAcctgctgtcgacgctgg
agcagtctGCAAGTTTTGCTAGTTATGTCGTGACGTACGATGGCGTTCTGAGTGGAAATGTCGGCGACGGTACTACAACGTTCATGCTGTATGGCGCCTG
TGTCGTGGGCACGATCATCGCTGGCTTCTTGAACTACTTCCTGGGCCGTCGTCTGTCTATCGTGGCTGGTGGTCTCTTTAGCACTCTCGGTATGGTGGCT
GTCAGTGCCAACGATGACCTCCGTTCGACTCTTCTGATGCCTGGAATCGGCCTCCTTGGTGCATCATGTGGTATCTTGCTTCCGTCGCTGGCGATTTATA
TCTTCGAAATTTCCACCAAGGAAATGCGTGGTAAGGCTATCCTGCTTCTAGGCATGGGCTTCATCGCAGGTAGCTTACTGGGTGGTATTTTCGCGACGGT
GAACCAGTTGGGATGGATCTGGCAGACATTTGCTGCTTGCATCGTTATCGCTTTGGTAACCCCGGTGGTCAACGTGTTCCCCGAGAGCCCCTACTGGGTG
CTAGAGCGCAAGGGATGGGATGCGTGCGAGGCCTGCTTAGTCATTCTGCGCCGTAAGCCTGACGTCcacgaagagctcaagatTATGCGTGAAGAGGAAA
CTGCAGAGGAgggtggtgctggtgctttcAAGTTCCTTATTGGCCTGTTCTTGATGCTTGTGACTTCGTTGACAACCGGCTTCTTGAACGCCTTTGTTAG
TTACAAGGGTGCAAGCGAGTACACCGACCAAGATAAGCTGTTCGTGAACGCCATGGCGTTGCAGATCTCGGGTGCTGTGattgccttcttctttaTTGAC
AAGCTGGACCACAAGTCTGTCCTGTTTGGAACTCTGATTCCGATCGCGATTTGCGCTGGCGTGTTGGGCTTCAACGAGACGTCCGATTTCTTGGGTGACT
CTGAGGGTTCTGGCCTGTACGTCAGCCTAGTCGTGATGCTcatgtacttcttcatgggACTTGGTACGAGCTCTGCTCCTTGGTCAGCTTGCGTTGGCAT
GTTCACCACGAGTGGCCGCGCCTCGTCAACTACCGTGCTGTTTGCCATCTTCTACTTGGCAGACTTGGGCTACGTTTACATGCACACAAACGACTCAATG
ATGGCGAACGAGTACTTCTACCTGTACGGAATCGCAGGTTTCAGTGTCATATCGCTGGTCCTGTTATTGGGCGCAGGCACTAAGAAGAACGGTATCATCT
GCACTAAATCGGAAGCCGAGAAGGACCGTGATCGCATTGCTCGCATGCGTGCCGAGCGCGCAAGTCGCAACACACGGACTCCAGGTACTGCTCGTCAGCG
CAACATGAGCCGTGTGCGGTCCAAGTCCAATGCAGGCGGCCAACGGGGCAATGCTACTCCTGGCAACTACCAGATGTACGAAACACCCGCCAATGCCGCG
CCGCCGCTCATGCACGCGCGCGCTTAGAGGG