Description :
From Genome Similarity Track
Location :
Scaffold_80:25054- 26368
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_80-snap-gene-0.9Titin

Sequence
1314 bases(100 bases per row)
TCACCATGCTCGTGAAGACTTGGTATCGGATGAAGTAGGTTGTGAGATACGAAAGGCGGTTCAGCACAAATGATGCGTTCTGTCCTCTGTACACCTCGCT
GAAGACTGATGGGAGCTTTTCTGACGCGACCACCACGGCGTAAGCAGTCAAATCTAAACCACCCAAATCCATCGGTGCCACCATGGTGAGATAGATGGCC
CCTCCGGTGACAAGGTTGGTCGTGATACCAGGAGGCTTGCTCGGAAGCGTTGCACTGCGTGTGGTCACTCGAATCGAATCCGAGGCCGAACCGACAATTC
CTTCGTCATTCACGGCATGCACAGTGGCATTGTAGTTGGTCGAAGGCAATAAACCAAACACGGCCTGAAATGTTGTGGCAACGTCAAAGACTCCCACTGG
ATCCCCCGTGCCTCGTATCACGGACACAGTGTACAGGCGCACGTTCGCACCACCCGAGTCCACCGGTGGCGACCATGTGAGATTGAAACCACCACCGGTA
CGAGTCGTCACAAGGACGTTCGTCGGGGGTGACGGGGCTGTCGGGTTACCGGTGGTGACCGTCACGGCAGGCGTAAACAAACTTTGGCCGAACGCGTTCT
TTGCGGCGACTGAGATTCGATACTCCGTGCGTGCAAGCAGCCACGTCAAGTTGAAGTTCTCAGCGAAAGTGGGCCACTCATGTGTGCCTGTGGACTGAGA
TACCGCGGAAACGATGTAACTCACGAACGACACGTTTGCGGCGCCACGGTTGACCGGTGTTTGCCACCCAAGGGCAACCAAACCACCACTGAGAGCGTTC
GCGACAAGTGCTGTCGGCACACTCGGCGGCGATGCGTCACCATCATCGACGATTTCGAGAACAGTAGATTGGACAACGCCAATGGACGCGCGGCCGCTGA
CCATAGACAGGCGAAGTCCGATCACTTTGCGACTCTGGTAGACTGCATCATTGATGACTTGAACGGTCAGCGTCGCGGAGGCTTGAATGTCAAGCAGTGT
GATGTTACTCGGTGGAAACATGAAGTCTACGTCTTGCACGGCCATAGCTGCTGCCGGATCTGGCAGCGGAACCGTAAATGCTTCTAGTCGCAGTTGAACG
GTCCGACTAAAGCCCCTTGTTCGGGTGATGCCAATCGCGATGGAACCAGCTGACTCCATTGTAGAGTACGCGATCTTCGCAAACTGTATGGTGCCTCCGT
CTCCATCATCAAGGATAGTCACGCGAATCGTGTCGAGAGCACCGATCGTCCCGGAAGCAGAGTCAAAAGCCGTGAGCTGGACGAAAAAGAAGCGGGCGGG
ATCATCAGTCACGT