Description :
From Genome Similarity Track
Location :
Scaffold_312:2505- 7480
Transcript NameFunction/comments
Aphas_H257_19342pol protein

Sequence
4975 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCAGGGTCCCGGTATGGCTTGAGCAAGCCAACATAAAACACCGGGTGCGTACGCATCTTCTTTG
GAAGATTGAGCGTGTACGCTAGGCCCTTCTTGGCCACGACCTTGAACGGCCCGATGAACCTAGGTCTCAACTTGGTCTTGAAGACCGCAGACACTGCATG
TGTAGGAAGGTTTTTAGCGTTTAATAAAACAAGATCTCCGATCTCAAACTGTTCCATGTTCTTTCTGCCTTTGGCATCTGCATACTCCTTTTGGAGATCC
TGGCTTTCAGCCATTGCATCGCGCACTCGGCGCATGACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGCGAATCGCAACTGGGCTGACATCAG
CAAGCCGATCGGCTAACCCTCCCCCATCAAGCCCAGAGCCACACCGTGGCGGCGATAGAGGGACACGAGGGTCAACCAAGCCGTTCACATAGAACGGGGT
GAAGCCTGTCGAGGCATGCACCGCATTGTTCATAGCGAACTCAACAAGGGGGAGCATCTCGCTCCAGCGTCGAGGCGCTTCAGCGCAGACACTGCGGAGG
ATATCCTCCACAACGCGATTCACGCGTTCAGTTTGACCATCGGTCTGTGGATGGTCCGCCGTGGACATGTCCAACTTGGTGCCAAGCACCCTGAACAAGG
ACGTCCAGAACTTTGCCGTAAAGCGGGGGTCTCGGTCAGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCTGTCTAAGAACAGCTTAGCTGT
AGCCTCACCGTCGACGGTGTCCGGCACAGCCGAGAGATGAGCCATCTTGCTCAGTCGGTCCACAAAGACCACAACGCCTGTGTTGCCTGCCTTATCCTTG
GGAAGGCCAAACACAAAATCCATGCTCATGGACTGCCAACATCCCGAAGGGACTGGCAAACTCGCCAACGGTGCAGCCGCATGCGGCGCGGACTTGGTCC
GTTGACATGTCTCGCATGTACGCACATAGGTGCTTGCCCACTTGTACATCTTGGGCCACCAGTACATCTTGCTCACCGAGCCATAGGTCTTCTCACGACC
AAGATGTCCACCGACAGGCGTATCATGCACCTCATAGAGGATGCGATACTTAAGATCCTCATCATGAGGAACAACCACTCGAGGAGTGTCCTCAGGGTCG
GTGCTGTAATACAGCAGGCCATTATCAAGCGTATAACGCTGCAGCCTCGCGCGTAAGCGCTGTGACAAATCCTTGTCCGAGTCTTTAAACTCATCACTCC
CGAGAGCACGTAGCAGGGCTACACAGGTGGCGTCTTGGGCATACGCCCTGCGAATAAGGTCAGGGACCGACGACGTCACCGTTGTGACGTGAGTCAACTC
GTAGTCTGGCCTGCGCGATAGCGCATCGGCCACTACGTTAAGCCGGCCCGGCTTATACTTCACCTCGAAGTTATATTCGGCAAAGAATGAAAGCCATCTT
GCCATTCTCTGTGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAAGGACGCATGATCTGTGTAGATCACAAAGGGCTTAGAGCCGAGTAAATGTACTCTAA
ATTTGACTAGAGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCAGCAGCCTTGAGCTGCCGAGACTCAAACGCGATAACGCG
TTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACACCCGATTGCAAAATCGGAGGCGTCGCAGACGACGCTAAACGGACGATACGGGTCCGGAAGCGCC
AAGATGGGTGCATGAAGGAGGCTCTCCTTAACAGCCTTGAAGGCGTCGTCATGAAGGACGTCCCAGCACCAAGGTGCATCCTTCTTAAGGAGATTGGACA
GTGGCCGAGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN