Description :
From Genome Similarity Track
Location :
scaffold_425:25047- 26081
Transcript NameFunction/comments
Pl_104995hypothetical protein PHYSODRAFT_254737

Sequence
1034 bases(100 bases per row)
CATGAGCTGCTGGCCCATGTCGGTGCACACGGACGAGAAAATCAGCTCTTGTAAATCTAGCTGCCATCCTTCCCAGGCTTCCTTCTGCAGATTCGAGAAG
TTCTCATCATACTTCTTGTCACCTGTCATCACCTTAAACAGCTCTGGGCTCTTCTTGCGTGCAGCGATCTCCATGAGCTTCTTGTAGTACTGGAAGTTCT
GTCCGTTCCATCGAATGGGTCGACCAGTCTTCTCAGAGACCTCGACCTCCCAGGACGCGTCCGTCGTTGGCTTGGGCATCTTCGCACTTCAGCGAGATTT
GGGCTCAAAACCCTGTTGTTGTGTAGATAACAAAATGAAGACTGACTTAGTTTGGTGTTAGCTACCCTTTCTCCGAGCTCCTACCAACACGAACGGGTTA
ACGCCCGTTCCCAGGCTACGACCTAGCTTCTCCAGCCATCTCAGCATATCTTCGTCAACCTCAGTTGAGCCAGGTCTCAAACTTGAATATGCATTCCAAC
AGGACTTGTATTTTATATCACATCGGCTGAACTGAGTCGAGTACATGTTGAACCAAACCAAGTACATTTGTAGCGGTAGATTGCAGTAGGTTGACGTTGA
AGTTGAAGAAGTTAGGAAACAAGGAGACTACAAGGACGTATTAGGAGACCAAGGAAGTACAAGACAATCTAACCAACGGCAACATACACTCAGTTGACAA
TTTCCTACTACTACAACAACTACCAGTGGCATTTTGCTAGAGTAATAACGCAGCGTGGCTATGACAAGATACGACGAAGAATCGACAAAGTCAGCTCAAG
ATGGAAGATACTATCGTATTCACCAAGACCAAAAGTGACGAGACAATAGTGAACAATGTTCCGTCACGGAGACAGGAAGACCTGGCTTAATTGGTCCAGG
AGCACTCGCCTTTTATGGGGTATACTCTATCACAGAAATATCAGTTTTCACTGGCCGACGACATGTTGTCGTACAGTTGGTGCTGCTCGATGACGATTAC
GGCAGTTCAATGACGCTGTTCGTGAAGAAGCCCC