Description :
From Genome Similarity Track
Location :
Scaffold_98:25046- 26180
Transcript NameFunction/comments
Phyta_totarag3526hypothetical protein

Sequence
1134 bases(100 bases per row)
GAAGGTGCTTGAGGCAGCCCAGAAAGACGGGGCCACCTCGGCGAGTCGTACTTCTCGCCCAGCAACGCCCACGATGAAAATCGTCGCTCGCAGAAAcagc
ggccagcagcagcagcagctaatAAGTCCACGTCACAACCACCATACCGCATTGGCTGCGGAGATTCAGCGTTACACGGCTACCAAATACGGCAACCTCA
GCGCAATTGCTGCGAAGGATGAGCAGAAGAAACTATACTTCGAAGAGTTTCACATCGATCCCATCCGCGCTACTGTCAGCTTCTCATTTGGTGATAGTGC
ACGCGCCATTGTGGACGGTCACTCGTCTTCACTATCGCATGCAGCGGCATTGACGgatccgtcgtcgtcgcgagAGTCATCCGTCATCACAGTTGGCCCT
CTACGACTTATCTTGAACGCTATCGGTACTAGTCTGACCAAGATCGCGAATGCTCCGTTCCAGCTCAAGGCGCTGCACATCCACAATTCGTTTGTACAGC
CTGATGCGTTGGCAACGCGGTTGGCGTCACATTACCAGAGTGAAGCGCTTCGCCAGGCCTATGTCATCCTTGGAAGTGTTGACGTGTTGGGAAACCCAAT
GATCGCATGGAAAAATCTTCGCAGCGGATTCCAGGACTTCATTTCCGAGCCAGCGCATGGACTTTCGCAGCGAAGTCCGCAAGCTTTTGCTTTTGGTGTA
GGGCGTGGATCACTGTCGCTTGTGCGCGCCTCAGTGTATACCTTCTTGGACTTTAACACGCGCATTCTTACGGCTTTTTCGCTCGGTCTGTCCGAGGCTT
GTCTGAAGCTGGATGATTACACGGGCTACCCGGCCACGCGGCACATTTTCCAGGGCCTCGTGCAAGGTGTCTCGGGTGTTGTGGTGGCTCCGATCCACTC
GTTCGAAGTAAACGGCGCACGTGGTGTGTTACCTGGCCTGGTGGCAGGTGCGTTCGGAGTCGTGCTAAAGCCGTTGCTGGGCTTCTCTTTGgtcacagca
acaaccgcTGCTACGCTTCGTGATGCTGTTGACCCCAACACCAAGGCACTGCTAGTACGCGTGCGGCCGCCACGCCACGTTAATCTTCGGACGAAGCGAC
TGAAGGTCTATTCGTATGTAGAGTCCTTGGGTGA