Description :
From Genome Similarity Track
Location :
scaffold_60:25039- 30264
Sequence
5225 bases(100 bases per row)
ACGTTATTATCTACGCCACCGACGATGCAGAAGTGCCTTGCACGTGCAATTCCACAGTTACGGTATTCATTGTCAATATTAACGAGCCACCATTCCTTGT
GGCTGGGCAAGTCGGATCTGTTCTTGAATTTACGAGATCACTTTCGCAAGACCCTTCCGTCGCTACTCTTTATGTGGTTGCGCAGGACCCCGACGAGGGC
GATAAACTATATTTCTCATTATTGAGCAGCAGTACTAGCAATCTCTTCTGGATCCACACAGGGACTGGTGGAATTTACATTACTGACACTAAGGCATTTG
ACTATGAAGTCCGCAAAGTGTATTACCTTGATGTGGTTGTTAAAGATTCAGGTGGGCTGACTGATACCAAGCAAGTGGAAATTCATGTTGTGGATACCAA
TGAGAGCCCTGTTTTTCAGAAAGTTATGGGCGCTGTCGATGAAAATAGTCCTGAAAACACAATAATCTTGAATTCCTACGACACAATCTGCACAGACCCA
GAAGGAGATGAAGTTATGTATCGTATCAACAGCACGGCAACCGGTCTACCGTTTGACTTTTTGAATAATCAGTTAGTTGTGTCAAGGGCACAACTGGATT
ACGAGGCAACTTCGGAATACATTTTTACGATGGAGGCATGCGATTCAAAAGCGCTCTGCACGCTGGCCACTTTTACAGTTTTGATCAACGATGTGAACGA
GCCGCCGGTGATTTTTCCGTCCCTCGTTAGTATTGCAGAAAATGCGTTGCAAGGTGCACTGGTAGGCTCTCCAATTTTGGCGTCCGATCCTGACCTTGGC
CAGCGATTGCTTTATAGCATTGCGGATACTAGCACGACCGATCTCTTTGGAATCCAGCCTTGTAATGGCCAAATCTATGTTAAGCGCTCAAATTCCCTCG
ACTTTGAACGAGATTCCTCATACCAAATCGTTGTGGATGTAAGTGACAGTGGGTCACCATCTTTGAAATCGTCAGCTACAATAACAATTGCGATTCATGA
CGTCAACGAAGTACCAATGCTGACAGCAGATTATGCGATTCGTGTATATATGACAGATGCCTTCGCTGGAGTAAAGAATTTTACTGGAATGAATTTCGGA
GACGCAATTCGATCTGCCAGGATTATTTGCAACAGTACCGTTGTTACTATTACTGACGTATCGTTCCAAACACTCTGTCCTCGGATGGCCCGAGAAGAGT
ATGGTGTGGTGATTGAGTCTAGCTTCCTTCTCCCGGAGGACAGCACTGTATCGTTTCGTGTCCTGTCTGGTGTGGAAATAAACACAGTCGCCTTAATTGA
CGAGGTGCCGTATTTAGTCAAACTATCGTACCGTCCTGGATTTGACTTGAAGTATTGCGATGAAGTCGCTTCTACCCTATTGCACCGAGGTTTGCACAGT
ATCGTGGTAATTCTCTATTCACTGCCGGAAAATACAGTGACATTAGAGCTTCAGATAAATGAAGGCAGTTGGAAGCCGTTATCCGTACAAACGTTCGATA
GTCTTGTAAACAGAACCATTGAACGCTCCATCTTCGAAAACAGCATTGCTGGGACACCAGTTGGAGACCCACTTCAGGCAATTGATGAAGACGAAAATCC
AAAGTTTTTCTATACGATAACTCAGCAGGAATCGGCTGGATTATTTACTATTGACAAGATGACTGGACAGTTGGCACTCACCGAGAATGGATCGCTTGAT
TATGAAACGCATTCATCATATCATTTGTTAATCGAAGTATCTGACACTGAGTTAGCAACCCAAGGACGAATTTTTGTTAGAATTCTTGACGTCAACGAAT
CTCCTGTCTTATCTAGTCCACAACGATTTTTTATTGAGGAAAATGCGAAAGCATACACGGTATTTGGCAATCCACTCTCTCCGACAGACCCAGAAGGTGT
ACTTGGGAACTACATGTTTGAAATACTTTCGTTAGAATCCACAATTCCATTCGAGCTCTCGATGACATCTGGACAGTTCATCGTAGCTGCAAATGCTGCC
ATCGATTTTGAAGTCCGGTCTACCTATCGCTTTCAGGTGAAGATAACTGATTGGGACAGTCTTGTGGTGATAATTGGTGTAATCATCGACGTTATTAACG
TTAATGAGCCGCCTACTGTGATTGTCACTGTGCTTCCGCTAATGGAAAATGCGCCGCAAGGAACTGTTGTCGCTCAAATCCAGGGTTTAGATCCGGAAAA
CCAAACCTTGTCGTTTTCTTTTTCCTCAAATTTTGCTGCTGATAAAAACAGCACTGGTTTTCGGGTTATTCACCTGTCTTCGAATAGTGCCCAAATAGAG
GTACGAGGCGCCAAACTCGATTTCGAGCAACAACGAAGTTTTGATATGGTAGTCACTGTGACTGATGCAAGTGAGAACAGGCTATCAACCGCGCAGATGT
TCACAGTAGAGGTTACGGACGTCAATGAGCCCCCCAACCTTTTCGTACCTTCGCCAGTGTATATGAGCATTCCCGAGAATACTCCAAATGGCTCGCTTGT
TGGTAGCCCTCTTGCAAATTATTTTTCTGACCAAGACGTTGGTGACAGTGTGACGATTGAATTGATATCTTCTGTACCTCTAAATGGAGTATTTTACATG
AGCAGTCTCGGCCAGCTATCGGTTCAGAACACAGTGGGTCTGGATTTTGAATCTGTGGCGTTGGTTCAACTCTCGTGCCGCGGATCCGACAGGGGCGGAA
ATAAAGTTGAGTTTCTTGTTAATATCGACATCTCCAACATCAACGAAGCGCCCTATTTTTCGGACTCCGTAGTTCAGATCAACATACCTGAATCGACCGT
TACTGGGACTCAGATGTATCAAGCTCATGCGTTAGACCCTGATGGATACGTGGCTGACATACGGTACTATATTATCAGTGGCAATTCCAACGCAGCGTTT
GTTTTGACCGAAGCGGGGGGACTAAAATCAGCTCGAAAGCTTGACAAGTCGGAAGTATTCAGTTTAATAATTGAGGCAGTCGATGAGATTGGAAAGGGTC
TACCATCTCTAACGAACCAACGCTTAGATATTTCGGTGACCAGTGTGAATGCTCCGCCAACTGTTTCTGATTTTGCATTTTTTGTAGATGAAAACGTTGA
AGTTGGTACGAAAATTGGTCAGGTCTGGGGTAGTGACACCTACATTGGAAGCGTCTTGACATTTTCTACTATTCCTGACACAGACAGGATTCGATTTCAT
GCTACTAGCAAAAGCACATCCGACGTCTACATTTGGTCGCCGTCACTTGATTTTGAAACGGAGCCGAAAATCACTTTTATTCTTTGCGCTGTGGACGATG
GAGTAAAGAATGATTATGTTGCCGTGATGCAGGGGTGCGGAAAACTCTCTATTTTTGTGAGAGATGTCAATGAGCCACCCAAATTCGATATATCTGCTCG
AAGTGGGCGAACAATTACGGAGCCAGCGCAACTAGACGATGGCATTAGTGAAAACCTTCACTATACTAATAGTGGGGGCAAGTTTTTCGGGAATATTTCT
CATGATCTTCTTACTGACGACAGTTTCGATTTTGTGTTCGGATACGCTGACTTCAGTACAGCGATGTCTATACGCACAAATACAACTGGAGGAAATATCT
TGCGCCTAAGTGGGTCTACTAGCGAGTACTTTGATGTTTCAGTGGGGATGGACGGAAAGTTGAATGTTTCGTCAAGTTCGATATTTGTCCAAGGCAAGAA
AAACCTGGCAGATGGCGCATGGCACTACCTAGCAATTATCTATACGATCAATGATCAAAACCTTCGACTATATGTCGAAGGTGTTCTCGATAGTACGACC
GTGGTATTTTTCGGCTCAACCATGATCGCACAGCAAGCCGTTTTATCATCCTATCTTGCTAAATTCACGGGATGGATCTCCAGGTTTCACTACTTTGCTG
GTGCAATTTCTCTTTCTGAGGTGCAAGAGCTACTTTCACTCTCCGGTACGAAATCCTATTACATCAACAACAAAAGTATCTAACATTGATATTGTTTTTT
CTTCCAGTGCCGAGTTTTTATGTTATAACAGACGCTTCTAATGATCCCGTCACGCAAACAAAAGGAAGTACATACTGTCATAACCTAGGTTTACGACTCT
GCGACTTGATGGATTTTGATTCGTTGTGTGTAAATTCGCACAATAATGTTTCAAGATTCCCGTCAGCTAGCCAAGGCCAAATGCGTGTACCCCATTGCTT
TAACAAGGTTTCTGAAGCTGAGCAAAATGCTGACAATGCTCAGCTCGCATGTTGTTCTCCATGTACGTCTATATTCAAATTTTATTACTTACTGCGATTT
TATTTTGACTAATGCAACTTTCTGGCAGTTGTTGATAGCAAACTCATCGGTGATTTATCCCGCCCCGTTCTCCGGACAACAGCATTGACTGCAAGTAGCT
TCCTCAATAACAGCAGGAGCCACGGATTTGGCAACGGGGGACTGGATGTCTTACGCAGTGATAATGTGGATGGGTCCTGGTGCCCGGCTTCCAACTCCCC
TTCAGAATGGGTTCAAATTAGCTTTCCGAAAGCAACAGTGGTTTCACGACTAGAAATTCTTTCAGGAGTCGACGAAAAGGGAGAAACAGGATATCTAAAG
ACGTTTGTGGTGGCCTGGAGACAATCAAGAGCTCACGAATTTTCAACCATATCGCAAGCTTCAGGTGCTGCGATCAATTTTAAGGGGCTGGATCATAATG
CTGAGAACGTAGCCACCAGCGTGGTTCTACCCAATGTCCTTGCTAGGGATGTTCGGATTATTCCAACGGCTTGGTTTGGTACTGCGTGCATGAAACTTGA
GCTTTATGGCCCTGATTCAGGTACGCTCTAATCCTTAGCATGTACACGAAGTACTTTAGAACTAACGGTTTCCTTCGAGTAGATTTCCAAATACCAGGTC
CACTACTTGCAGTCGATGGTGACGCTAACGACCAGATTCGATATTACCTTCGCGATAGTGATCGGCCTTCAGGCGTTCAGATTGACCCATTTTCAGGTTT
CCTCACTGTACGTCGGCGTTGGATTGACTTTGAAATGGATTCTATATTACGCTTTACGGCAGACGTTTATGACAAATCTGGGCTAAGCGATAGCATCACA
GCCGCAATTGCTATCCTAGATGCTAATGACGCACCTTCATATGAACAAAATACCTATGCTCTGACCGAAAATCCAATCCAAGGTATAATACTGGGTAAAG
TTCTGGCAGCTTCGACCGAATCGAT