Description :
From Genome Similarity Track
Location :
scaffold_189:25031- 26703
Transcript NameFunction/comments
g5360.t1hypothetical protein

Sequence
1672 bases(100 bases per row)
GCTGACGCGATCTGGCTTCAGGCTCGGGCTCGTCGCTGTCGATAACTGAAAGCTTTCGCTGCGCGTCTTCCAGGCTACGCTGTAGATCACGGATCTTCTT
CTCCAGCTCGTGAATCTCACTCGCGCGTCGTACGGAGTTGGCGAAGTTGTGGGAAGAGCGTCTATCATCTTCATCTTCGTGTTCCGAACCATCGTGTTCG
GGTTGGTACGTTGCCATGATCTTCTCGTAGTTAGAAGCGGAATATGGATCGGGACTTTGAGCCGAGCTATCGTCGCTGTCGTACACGGTCGGATAGCTAG
CAACCGATGCTGAGCTCGCCGATACGGCGTCATCATCGTGATCTTCTTGGTTGTCTCGAGCGATATTCAGTTCTTGCTGGCGGTCTCCAACAGATAAAAA
CGCTTGGCCGGCCTGACTCGTGGCTCGAGCTGCTGCGAAGGTGATGCGAGCAACCGAATTGAATTGATCAGGCGTCATCTCGCCATCTCGTTCACTGCCA
TCTCGTAGAGAGTCCTGACTGCGGTCACTGGGGCCGGAGTAATACATTGCAGGCGCTGCATTCGTAGCATTCGCCAATGCAGCATCAAAGTTTGAGACGG
AGCTCTCCAGCGCCTCACGGATGCTCGTGATCTCACTGTACATGTCATTGAACTCTTCCGTTTCATCACTGTCCTCGTTCTGCCGTTCTCCGTACGCTGC
CTCGGACATCGTAAGGTTAATCGTGTCACGAACCTCACGAATATGAGTCACCACGTCCGTGAGAGCCTGCATTTTGTCCTGAGGTCGCACCTGTGGACTG
ACGTCAATTTTACGTGAGGGGTTTGCAGGCTTCAGCTCGGTGTCGGATGCTTCCAGCACTTCCATTGCCAGATCACTCTGTCGACGATCGCGATCGCGAG
ATTCGCGCATCTGGAAGATCATATCCTCGTAAGAATTGTGTTGTGGACTGCGTAGTCCGCGCATGTACGACTCCGTGTCGTTGGATGTAGATGAAGCAGG
TTCATCCCCGGTTCCAGTTGCGCTCACTGCCGAGAACTGCTGCTGTCGTGCACCAGCACTGGTCATACAGGCGGAGCAGACACGTAAATGGGTGATGTCA
AAGATCGGTTCTTCCAGTTCTCTCAGCAACGCACAGGACGAACAAACCACTTCTCCACATGTCCGGCAGTGGTGTTTGCGCCGGAAGTAAAAACCCCGCA
AGCAAACTGCACAAGCTTTACGGTCCGAATTCGGCACCCATTGCCACTGCTCCACGAATCTCAAGCTGCTCACTCGCTGACGAGCTAAAAGCCCCGGAAT
TTTAGCCACTGCACAAACTGTTTTCTTCATTAACTCCTCCAGAACCCCTCGTACAATCGGGTTGAGGTCTCCGTCGATCTGGCAAATAGAAGTCACTTTG
AACGTGTTGGGCTGGTGCGTTTTAGACACAATAATGCCCATTCGGGACAAATATCCTCTCGCGATCCCGAAATTCTCCAAAGTGGGTACTTCTCGATCGC
GAGAAATAGATTCCTGGACACAGAACCCTACCACATTAGATCCGGGGTGGGGTTTCTTCTTGCCGGCGTATTCTAAATAGCAAAAGTCCAAAATCTTCTG
ATCTTCTCCGTGTCGTGGGCGCTGGGTCTTGAAAGCGTGCCACTTTATGGCACGATACGAGTACGAAGCTCT