Description :
From Genome Similarity Track
Location :
Scaffold_33:250307- 254969
Transcript NameFunction/comments
Phyci_458626Hypothetical protein
Phyci_6401ATPbinding Cassette (ABC) Superfamily putative

Sequence
4662 bases(100 bases per row)
ATACGCGATTGCGCGGGGAGAAGGTCGTGCCAGTCAATTCCCAGGTTGCGAATGACCTAATCACGAAAACTGAGGCCACTGAAAACAGTGCGTTGCAACT
TCTGCAACGATTTGTGGCTGCGCCTACGGTGCATGCGGCACTGCATCTCCAAGGTGTGGGTATATCAATTGTTGATAGTGCGCCTAAGGAGCTGCTTTAC
ATGTCGATCTCTGGTATCGCGTTGGAGGTCCTTATCAGCGAAGATGACCGAAACAAAAGCGCTGGATCGATCGCTGGAAGTGCAGCTTCACTATCGCGGC
TCGAACGTGAGACTCGTCCGCGAATTATTGCTTGCTGTCTCGAGGTGAACGACGTACAAGTTGACAACCAATTGCAGGTGACACCATATCCTGTGCTATT
GCGCTTTTCCAATCCAAACGGTAGGTCGAGAATTGTCAATGGACAAACGGTGAACATACCAGTGTTGCAGGTGGGCCTTGTGAAACACGACGAGTACGCT
GGTATCGAGTTCATCAGACATTTCAGCGTGAGTGTTTTACCTGTGCACATCCGGGTTGACGGAGCACTTCTGTATCAGATACTTCCGTTGCTGGTACATG
CCAAAATCTACGGCAGTGGTGGGAACAGTGCGATGTCGATTAAGAAACGAGCCGTAGTACTGGTGAACGGTGACATTAGCAATGATGAAGTCTCGCGAGC
TGCCCACAGTCACTTATTGCTGAAGGATTTCAACGCCAGCCTGGAGGTTCCGGTAAAGGTTCTTGAGGCCGCTCAGAAAGACGGCACTACTTCAGCGGGG
CCTACTTCTGGCCCGACAACGCCTACAATGAAAATGGTCTCTCGAAGAAGCAGTGGTCAGCAGCAATTGATAAGCCCACGACACAATCATCAGCATACTG
CACTTGCTGCGGAGATCCAGCGTTATACGGCAGCCAAGTATGGGAATCTTGGTGCAATCGCTGCAAAAGACGAACAAAAGAAACTCTACTTCGAAGAGTT
TCACATCGACCCCATCCGCGCCACTGTCAGTTTTTCGTTCGGTGATAGTGCAGGGGCCATCCTGGATGGTCACTTGTCTTCACTGTCACACGCGGCGGCA
CTAACGGACTCGTCATCATCGCGAGATTCATCTGTCATTACAGTCGGCCCTCTACGATTGATTTTAAATGCAATCGGCACCAGTCTGACCAAGATCGCGA
ATGCTCCATTCCAGCTTAAGGCGCTACACATCCACAATTCGTTTGTGCAGCCCGACGCGTTGGCCACACGCTTGGCGTCGCATTATCAGAGTGAGGCACT
CCGACAGGCGTATGTCATCCTTGGCAGTGTTGATGTGTTGGGTAACCCAATGATCGCTTGGAAGAACCTGCGCAGCGGATTCCAAGACTTCATCTCGGAG
CCAGCCCACGGACTTTCACAGCGGAGTCCGCAGGCGTTTGCTTTTGGTGTGGGCCGTGGCTCGCTGTCTCTTGTCCGGGCCTCCGTGTATACTTTCCTGG
ACTTCAATACGCGCATCCTCACGGCTTTTTCGCTTGGACTGTCAGAGGCTTGCCTGAAACTGGATGACTACACAGGTTACCCAGCCACACGGCATATTTT
CCAGGGTCTCGTGCAAGGTGTCTCGGGTGTTGTGGTGGCGCCGATCCACTCATTTGAAGTGAACGGTGCGCGTGGGGTGCTGCCCGGCTTAGTAGCTGGT
GCTTTCGGAGTCGTACTCAAGCCGCTACTGGGTTTCTCTCTAGTCACAGCTACGACCGCCGCTACACTTCGCGACGCAGTTGACCCTAACACCAAGGCGT
TGCTAGTGCGTGTACGACCACCACGCCACATTGATTTGCGGACAAAGAGACTTAAGGTCTATTCGTATGTGGAATCCTTGGGCGAGGAGATTGTTGGCAA
AATCCGTGGCGGTCGTTACCGTACCGATGGATACCTGGGCCACGTGGATCTTAAGACGACTCACCAGTGCTTTCTGGTCACACGCAAGCGCATTCTTTTC
TTGAATGTAAAGGGGTTGGCATCGGCGCAAACGACTAAATATGAAGTAGAATGGGAGCTGCTTGCGGAGGAAGTTGTTATGGTGGACTGTTCCAGGACAC
CCAGTGAACAGATTGTCACCATTTACTACATGGAAGACGAATTTCGCGCTGCGAGTGGTGCAGGGCACAGTACTCGCGTTGCCAACGGGTCCAACGCTGT
GATCACAAGCCGGCGACGAACTCCTGGTGTACCGCGGGGCATGTTCTTGCAGAAGCACGAAGTGGCACTGCCCGACACGAAGGTGTTGTTCGTCCGCGCT
ATGCTTCAGCAGCAAGAACGCTCGCTGCTTACCAAGATGAATAGCTACACAAAGGATGGCACGCCGCACCATGTGAGTCCGGTGTCGTCTCTGGCTAGGA
CGAACTCGCTGGATCTTAGTTCTGCGTGGCAGCCCCAGCATCCATACATGCCTGTGGAGTACCCAGTCTTCCGTCTGCCTCCGACGTTGCATCAAACTCG
CAGTTTTGCCAACCTCGCGCAGACGACGCCTTCGCATTCCCACCACTTCACTTAGCAGCCAAGTCATAGCTCGAACGAACGCTAGATAGGATATCAACAG
TGTATACATGTACTTTCACATTTTGATGTAAACAACTTGTGTGTAGGCAATCAAAGCGTTGAACAATGTGTATAATTTGCTGTGTTCTAGGAAATGCACC
TACCTTCAATGTCTCCAATTCTACGCGATCTCAGCGACTTACCCTTCTTGATCGCTAGATGTCGATCCTTCACCTTCGTGCTTGCGCTGAGCATCCCACA
TTCCTGAGTAGATACTGTTGGGTTGCGCCAGTAGCTCGTCGTGCGTGCCACGCTCGGCAATCACGCCGTGTTGCATTACGATGATCTGGTGTGCGTTGCG
AATCTGCCGTGACAACACAAAGCACGTGAGTAAATACCCTGTCCCAGTCGCTTTGCGGGCAACGTACCGTGGATAAACGATGAGCGATGACGAGCATAGT
ACGATTAGCCTTGAGACGGTTGAGTGCAGCCTGAATCTCTTGCTCTGTCACAGTGTCAAGTGCCGAAGTAGCCTCGTCCAAAATGACGAAAGGTGGGTCT
TTCAGCAATGTGCGCGCAATAGCGACTCTCTGCTTCTCACCACCGGACAGCTTGAGTCCACGCTCACCCACCTTCGTGTTCCACTGATCAGGAAGCTTCA
TGATAAAATCATAAATGCGGGCAGCCTTAGCCGCTTCGACAACCTGGTCGAACGTAGCGTTCAAGTTGCCGTACTTGATGTTTCGAAGAATGGTGTCATT
AAAGAGCACCGTATCTTGAGGCACAATACCGATGGCCTGACGGAGCGACTGCTGAGTCACCGTGGCGATGTTGTGGTGATTCACCAAAATTTTACCAGCG
TTGCATTCGTAGAAGCGGAAGAGCAGTCGCGAAATGGTGGTCTTGCCAGCCCCAGTCTCGCCCACAAGCGCAGTAGTTGTGCCGCGAGGAATAGTAAAGT
TCAGATCTTTCACGCCTGTGGTAGCTGGCTGTGTTGGATAGTGGAAAGATACGTGGCGGAAGACGACGTCAATACCGTTCTCCGAGTCGTACTTGCACAC
ACCGAGCTGCACCGCATCAGGCGAATCAATAATGTCAGGTTCCACCGAGAGCAGCTCGCTCAGCTTCTTCATGTCGACGACCGAATTAATAACCATGTTG
TAGATACCACCAAGGAAGAAGAGCGGTGCAAAAAGGTTTGTGAGATATACGGAGATGGCGATGAAGGCACCGATGTCGATCCTGCGTCCGCTGTTCTCAT
CGACCACATGAGGCGCTGCCAACGCAAGTGCCGCCAGTACGGTAGCCTGGATGATAATCGACTGCGAGCCATTCAACACACTGAGTGAAGCCTGTACAGA
GACCGAGTATCGCTGGTACTTCTCAATCACCTTGGAGTACTCATCGATCTCATGGCGCTCGTTACCAAAGTACTTGATGGTCTCGTAGTTCAGCAGCGCA
TCCGTAGCCTTGTCATGGTACTCGTTATCATGGCGCATCGACGCCTCGCGGTACTTCTTACGCCAGAGCGTGATCTTAATGGTTAGGTACGCGTACACCA
CCAGACTGGAGAAGGCCACAAAACTCAGCCCTGCTAGTTCAAAGTGCATCGCGAAGATCACGATCACCACCACCGATTCAGCCAAGGTCGGAATCAGGTA
CAGGAACACGTAAGACACAACGCTGTTCGCTGACTCTACGCCGCGATCCATTGAGCGCAGCACGTCGCCGAGTTTCTTCTGCACGTGCCAGTCGTACGAC
AGCGACTGCACGTGCTCGTAGGTCAGCGTAGCCAACTCAATGTACGCCGTCTGTTTCACCTTGAGGTAAATCAGTGATTGCATCTCCTTGAACAGCTTCG
ACACTAGCGTGAGACCACTGAAGATGGCGATGTCACGAATAGCGCCACCGATGTCCTTCGCCACCAGCGAGTTGGTAGCAGACGCCATGAACAACGGCGC
CGCCAGATTCGCCAGCTTGCTCAGGATCAGCACCAAGTACGTACTCGCCGCTCGCATCTTGTTCGTGAACCCGTGCGGCCAGAAGTACGGCTTCAAGATG
TAGACCAGCTTCACAAAGGAGATGCCGCGCGGCTTGGGCGCCTCCGTCGGCCTGTCCGCAGC