Description :
From Genome Similarity Track
Location :
Scaffold_564:2503- 3514
Sequence
1011 bases(100 bases per row)
GTCCCAACCATGTACCAGATAGAAAGGGGTTTCCCGCCGAGTCGAGTCTCTTGAGTTGTTGATAGCGTGTACTATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCCACGTAGACCCGTACAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTTACCGTTGGCTTGTGGTCGGTAACTCAGCGTAG
CTCTTGATCTCGACTGCATCATCTCGGAGAAAGTTTGAAATACTTCACTCATAAACCTTGGATCTCGGTAGTGCCGTATCAGAGACGGAGCCCCGAAATG
CCTGAAGACGCATTCTTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGTAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGT
AACCTCTTAACTGTGGTTTGCTCTTACTGGTACTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTCGTAGTCGGC
CTTGACTCGGGGATAAGTTCTGACGATGCCTTGATGTCCCCCTTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCATAGTTGACGGAATCACC
AATCTCAATGAGAATTTCGGTTCGCCGAGTTCGCCCTGTCGGCGAGTTTCATCTCGGCGGTATAGCAGGCCGTCTACGCTGAGTACAAAGACTTCTGCGA
CTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCGCCTCTCAGGTACACCTTCAGATCGGCCCACCTGAGCTCTTCGTCTTGTGCCTT
CGCGATTCGTCGTCTCCGCTCAGTCTGTACTGTCACTGGATCAATGTCGTTGGCATTCTGAGCCGTCTGGGCTGACTCCATCTGCGACCCTGTTTCAACA
TTCGGGGTCGT