Description :
From Genome Similarity Track
Location :
Scaffold_2:25027- 27377
Transcript NameFunction/comments
Aphas_H257_00930conserved unknown protein
Aphas_H257_00931putative p22 protein precursor

Sequence
2350 bases(100 bases per row)
TCTGCGCTTCCATCTCTCTTAGGCCGCGAACTCGCGGAAGAGAAGGCCAACTGCTTTGTCGGCGAAGAGCTGGAAGCGCTCCGTGAAAAGGTGCTGGCCA
ACTTCAAGATCCAAGACACGCCGGGTAACTTGGACATTGTGCTGCTCAGCAAGTACAAGAACGAAGCGATCGACGTCAAGTTCAATTGCCAAGACGTGGC
TGACGTAGCCGAGGAAGGCGGCGAATACGACGAAGGCGAAGAAGACGAGGCGGAAGACGCCGGCGAGTTTGAGGACGACGTGTTGCCGTGCATTCGGTTC
ACGGCCCGCATCGTCAAGGACAACCACGCGTTGGTCTTTGACTGCGTGGCGAGCAGCGTGTTGACCGTGGAAGGCGTGATGCACACGGAGACCGCGGACG
ACCTGAACGACTCGGACTATGAAGGTCCGCGCTTCGCCGACCTCGAGGAAGACGTGCAGGAAGCGTTCGCCGACTACCTCAACGCCCGACACATCAACGA
CGACCTGGCCAACTTCATCACGCAATTCTCCGACCTCAAGGAGCAGAAGGAGTATGTGACGTTCTTGGAAAACGCCCAAAAGTTTACCGAAGCGTAAAAG
TAGACTTGTATTACTACATCATGTTGTTACTCAACAGCCCTTGCAACTTGGCCGCCACGGCTGGGTTGGACATGTGTCTGCAGAACGAAATCCCATCAGG
CATGAAAGACCTATCAAGGGACCTCTTACCGCATCGCCGCTTGGGGGCCACCCTGGTCCATGTCGTCAAAGAACTCGGCCATCACGGGGTCGCCGCGCAT
CGCATTCACCTGGACCACTTGGTTAAAGCCATGGATTCTCTCGTCGATGGATGACAAGAGACAATACCTGGGGGCTGTGACGAAATGACTCGATCGCTTC
GGGCGTCAACAGACTGCTCAAGTCGGGCGCGCCACCGCCGCCGCCGCCCATGGAACCCATCATGCGACTCAATGCCGCCGGGTCCTTCATCATGTTTTGA
GCCCTATGATCATAGTCCATCCATCAGATCATGCTGTATGTCCATCGTAGTCCATGTGATGATGATGATTGTACATGGCCATCATTTGGGGGTTTTGCAT
CATCTGCGCGGCCATTTGCTGCATCGCAGGGTTGCTCATGAGGCCCGCGAGACCGCCGGCACCGCCACCCGCGCCGCCCATCATGCCCGCCAATGCACTC
AAGTCTGGCATGCCACCGCCACCCGCCGGCGGAGGTGCATTGCGTGTCTAAGGCAGGCAAGTGTTGAGATCGCACCAAAACATGTCGTTCAAAATGGAAA
CGACGATGGAGGACAGTCGTGAGTGAAAACGCTACCTGGAGATGACTTTGGCGGTTGCGCGCGTCGTGCAGCCCCGACTTGCACATGTCGTTGGTCGGGT
CCACTTCGAGGCCGCGACTGAACGCGTCGATGGCGAGGTCGATGTCTTCCAGCTGCAGGTACGCGGCCCCGAGGCGCGAGTACGCCTTGACGTACTTGGG
CTACAGAGAGATGGTGGCATTGAATCCTCCAGAAACGAATGGACCGCAGCGTTGTTGTACGTTGAGTTCGATCGACTTTTCGCAGTTGTCGACCACGTCG
TCGTACTTTTCGAGGTACATTTGCGCCGCGGCCAAGTTGGACAGGTAAATGTGTGAGTTGGGGCCGGCGGGGGATAGCGCAATTGCTTCCGAGTACAATT
GTTCGGCCTTGACGTAATCTTTGGCGCTCAACGCGGCGTTGCCTGGATCGTAACATGTTAGCTATCGGATCGTCTAGTAGTAGGAGGATGGCACGTAGTA
GTAATACCGCTGGCTTTAAGCGTTTCGGCCTTGGCCTCCTTCTCTTCCTTGGAGAGCGACGGCGGTGCCTTGTCACTGCCAAACTTTTCCTTGAACTTGC
TCAGAGCTTTCTTGTACAAATCATCGTATTCTAAGCCAAGGTTCCATGTGAGCAACATACAAGCAAGATGATAACGGACCCGAGGTGCCGGGGGAGACGC
CGTTGAAGAATCCCTTGGCCTCCAATTTCGCAAGCCACTTTTGCCACAATCCAGGGTCTATGGAATGTGCTTTGCATCAGCATCGAGTCGAACAATCGAA
AGGAGGAGGAAAGAAGCATCAACACGTACTAGCAGCAATCACGGGATCTTCTGCGGCAGGTGCAGACAATGTCTAGCATATTTTGTACATGGGTAAAGGT
CAATCTTGTTGCCGCGAGGAGCGATCGTACCACGAGTTGCAACGATTTGGACCCCGCAGTGAAGATATCAAGCAAGGAATGGTTCTTCAGACCCAGGCGT
TGCTTCAACGCAGCATCCGACGGATTCACGTTGAATGCTTCCCTGAGTTA