Description :
From Genome Similarity Track
Location :
Scaffold_945:2502- 3912
Transcript NameFunction/comments
Phymu_g12403hypothetical protein PHYSODRAFT_249657

Sequence
1410 bases(100 bases per row)
TTTCGGTGAAGTCGCACGGAAACAAGCTGAACCAGAATGCAAGTGTAGTTGACCTTCGCTGGTTAGTGTCCTGGTTCAAGTCCTTTGCTGCCTCCGTTGG
TGATGTGGTGCCAGTACGTGTTCGCCGCCAGGAAACTAAAGACGGGTCGGTCAAGCTCTATTACTCCGACGCCGAATACACTCTCTTGCCAGCCAGCTTC
ACACGGTCGCAGTTGTACCGGGAGATGCACAACTACGTGGAGCTTGGCCTGCGTGTTCGAGAGCCAAGGCCGAGCACGTTTCGTCAATATCTCACGAAAC
TGTGCCCCAACATTCGCATAAGATCTCACCGAAGCAACGTGTGCGATGTGTGTAGCATCTACTGGTCACGGATGCAGAAAGgggcaacagcagcggagac
gGAAGCGTTTGGTGATCATACTATGGAAGCGAGGCGTATGAGGTGAGTATGGTTTCAAGCATCATTTTGATTTACTAGTGATATTCCTTTATGGAAACTA
ATATCATTTTGTATTACTGTCGCTTTATAGGGAAGAATACAAGCGCGACATGGCCGCAGCTGATGACAACAACGCTGTGATCATTATTGACTTTGATCAG
AACCTCACGCTGCCTAGTGTCAGCAGTACTCCGTCCCAGTAGTATTTTCTTTCGTTGCGAAGTGTGAGCTTGTTTGGTATTTATTATACCAACAAGAACA
TACAGTACAACTACGTGTACGACGAGACTGTGACCGGCAAAGGGTCAGATGAAGTTAACCCCATGCTCCACCATTTCATCAAGCGAATTTTGATTCCTGC
GGGGTACAGGAAGCTGACAATCTACGCCGATAACTGTGGGGGGCAAAACAAGAACAGCTTTGTCGTGCGAATGCTGCTTGCATTGACACACATGTCGGAC
CTCGAGGCCATCTTGTTCAAGTTCTTCGTGAAAGGCCACACGAAGAACGCGGTCGACCGTGGGTTTGGACACGTCCGGAAGCATGTTTCTCGTGCTGATT
TGTGGACAATGGACCAGCTTCTAGAAGCTGCCAACGATGCGTCGACCTCTTCGGCTCTAGTCCACATACCAAAGGAGAATAACATCTTTAAAGGCTACCG
CGatgtcgtcgacgacgcctACAAAAAGATCAAGGATATCCAGAGGTTTCAGATTTTCGAGATGCAAGAGGACAAACCGGGTGTGGTTACATGCAAGAAG
GGGCCAGACTCCGTTGGAGTTGACCAAGACCTGCGCCGGAAGTATGACGGTATCGTCACAGAGGGGACACGCGTTCGAGTCCTTTTCGACACCGATCTGC
AAGCCCTGCCCAATCCTCCCCCGAACTCTGAAAAGATCCAGACGATCTATAACAAGGTGCAGCGTTTCGTCCCTGAAGAATTTCAAGATGATTCCTTGTA
CGATCCTCCA