Description :
From Genome Similarity Track
Location :
contig_98:25015- 28181
Transcript NameFunction/comments
g13370.t1KUF83801.1 pectate lyase D [Phytophthora nicotianae

Sequence
3166 bases(100 bases per row)
GGAAGTCGCATGCGTTTTTGCAGCGGCTGGGTTCCGGAAGATGCAGGCATAAAAAACGATAGAGTTACGTCCGCCTCCTTCGTCCAATCTGTTGCCATCG
AGGTCTTTGGTTCTGGCAATCAAATGCTGTGGGACGACGGTACCCTAGCCGTGTGCAGCATCGCCCAGCACAGCGTGCTGCACTCTAGCGCTGGACGTTC
AGTTCTAGAGTCTGGATGCTGGGTTGGCACATGTATTATAGGTTTCTTTCCGTCCACCCTGCTGCTGCATTACATTTATGATTGCGGACATTCTTCTCTC
CGAATGGTGACCTCGCATTGTCGAAACCACTTCAGTGTCCAGCTGGGGCCACTCGAGTGCTGGACGGGCATCAGATCAATTGTACGGGCACTAGGAATTC
CCTGGCAGGGAATGCTTGATGCGTGCACCGTAGCGGCATTACAGTCACCCTGGAGGGCCCACTTCTATAGGGAACAATTTTGCGCTCGTGACGAGTTGTG
TCGTGATGTGGCCACCTTGAGCGGTAGATCAGCTGGAATCGAGAATATCGCGCGCAACAGCGAACGCGATTGTTGTTTCGGCTCCTGCGCTCTTCGTCGG
GCGGTGCGTGCGTGCGCTACAGCGGTTGTGGGTGGGCTCTTAGCTGGAGAGAGCAGGCCTGCGGCGATCGACGCTGGGATAAGTGAACCTGCTTTGGTGC
TGAGCGCCGCTGACGGCCACGATCGGTGCAGCCGTGTGGTGTTAGAGAAGCAAAGCTGTCAGCATTCTTGCAGATTAACACGACTACCGGAAACAGATGA
TTAAGGAACTCGATGAACGACGAACGATTATGAGCAATCTCTACGCCAACAACTTTGAGGCAGCGGAGTCCCATTTTCAGAAACTTTTGAGCTCTGCGGT
GCAGTGTTGCTTGCTCGCCATTGAAAATAACTCTACTGCGTTGGATCAAGAGTGCAGTGGTGTATACCCACATTAGAGCTCCAAGACAAACGTCATGTTG
TCCGAGCAATTATGTTTCGTGCCACGAGTTCTTTGACGATCTGAAGCATCTGTTTCCGGTAGTCGTGTTAATCTGCAAGAATGCTGACAGCTTTGCTTCT
CTAACACCACACGGTTGCACCGAGGTCGTGGCCGTCAGCGGCGCTCAGCACCAAAGCAGGTTCACTTATCCCAGCGTCGATCGCCGCAGGCCTGCTCTCT
CCAGCTAAGAGCCCACCCACAACCGCTGTAGCGCACGCACGCACCGCCCGACGAAGAGCGCAGGAGCCGAAACAACAATCGCGTTCGCTGTTGCGCGCGA
TATTCTCGATTCCAGCTGATCTACCGCTCAAGGTGGCCACATCACGACACAACTCGTCACGAGCGCAAAATTGTTCCCTATAGAAGTGGGCCCTCCAGGG
TGACTGTAATGCCGCTACGGTGCACGCATCAAGTATTCCCTGCCAGGGAATCCCTAGTGCCCGTACAATTGATCTGATGCCCGTCCAGCACTCGAGTGGC
CCCAGCTGGACACTGAAGTGGTTTTTAGACAATGCGAGGTCACCATTCGGAGAGAAGAATGTCCGCAATCATAAATGTAATGCAGCAGCAGGGTGGACGG
AAAGAAACCTATAATACATGTGCCAACCCAGCATCCAGACTCTTAGAACTGAACGTCCAGCGCTAGAGTGCAACACGCTGTGCTGGGCGATGCTGCACAC
GGCTAGGGTACCGTCGTCCCACAGCATTTGATTGCCAGAACCAAAGACCTCGATGGCAACAGATTGGACGAAGGAGGCGGACGTAACTCTATCGTTTTTT
ATGCCTGCATCTTCCGGAACCCAGCCGCTGCAAAAACGCATGCGACTTCCGGATGGCTAGTCAAACCTGCAGTTCGGTCTCTGAGTCACGCCCCGACTCC
GACCATGGCAAACTATTCGCACTGCAGAAACCTGTTCGGTAGACTGCCGTCAAAACGGTTGGGATGCAACCTTGGTCGTATAATCCATGGCCTCAAAAGA
AGTACTTGGCGAATTGTCGATTGGAGCGAACAAGTGGTTTCGCAAAACGTCAACTTGTCAGTGCCAACAACACCGCGCCATTGACAGGCATGATCCATCG
TCACGGATTTGATACGTGAGCGAGAAGAGCCGACGGGGTCAACCACGTCGGTTCACCCGCAAACCGCATCCAGCAGGACGGCTGCAGGAAAACAACTGGG
ACTACCGATCTTGGCGTTTGGGACGCAAGGTCCGCCAACCCGTTGCATCAGTGTCGCCAAGGCTCCGAACAAACGGTCACAGCAATCCCTGATGGCCGCG
CAATGTCTGACTAAACCGTTAGTCGGTGCCAACAAGTCCTCATTAATCAATTTGCCTCCCCGGCAGCAAGTGGCCAAGCATCCAGCCAACTCCACACATT
TCATTGCTGCAATTAACAATGGCCAAGTCCTTTGCATCGTTCGCGGCGTCCGCTGCCCTCCTCGTTGCAGCTGCGACTGCTGCCTCGTTGCCTGACGGCA
CGTGGCCCGCCAGCACCGGCACCGTGCAGTACTCTGCGGCCTACACGGTCAAGGCCGGCGAGGTCTTCGACGGAAAGATGCAGACCTTTGAGCGCTCGGA
CATTTCGTGCGAGGGCCAGACGGAAAGCGGGTCGTCCACAGCCGTGTTCCTCGTGGAGGCCGGCGGCACCCTCAAGAACGCCATCATCGGCAAGAACCAA
ATGGAGGCGTGCACTGCGACAAGCACGACTGCATCATTGAGAATGTCTGGTGGGACGACGTGTGCGAGGACGCCCTGAGTGTCAAGGGCTCGGCGTCTAG
CGTGACGAAGGTCATCGGCGGTGGCGCCCGCTACGCCGACGACAAGGTCATCCAGCACAACGGCTACGGCAAGGTCGAGATCGACGGCTTCTACGGCGAG
GACATCAGCAAGCTCTACCGCTCGTGCGGCACGTGCGGTGACAAGGCCCGCAAGGTGTCCGTGTCCAACGTGTACGTCGTAATCCGGCAACGCCGTCGTG
ACGGTGAACAAGAACTGGAACGAAAGGCCACGCTGAGCAACATTTGGATCAAGTCGAGCAAGTCCACCGTGAAGGTCTGCCAGTGGTCGCAGGGCAACGC
CAACGGCGAGCCCACGATCCTGGGCAACGGTCCGTCCGCTCCGCTGTGCCAGTACTCGGAGAGTGA