Description :
From Genome Similarity Track
Location :
Scaffold_236:25013- 27956
Sequence
2943 bases(100 bases per row)
TTGAAGGTTGACATCTACAAGTACAGAGGAGTTGAGGAAGACTCCCTGTTGTTATGGTTTGCCGAACTAGACAGAGCCATAAAGGCACGCCGTATCGACG
ATGAGCAAATGAAACTCACATTTGCTCAAGCCAACTTGGCGGGACGCGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGCGAACCATATGCTTTTGGGTC
GCTGGAAGCCTTTAAACTCGACTCAAACAGACGTTTGAGCCTCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAACTCAAGCAGGGTAAGCGTG
ATGTGCACACTTACGCTCAACACATACGACTCCTCGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATGCAAGGGCT
CGCAGATGGACCCGTCAGGAACCACCTGTTCCACTTAGAGTTGAATACGCTTGAACAAGCAATGTCAGCTGCGGAACAGGAGGACTTTAACATGATGCAG
GCTCATGGTAGCTCGAGCTCTTATCGTCCACCGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATGTTGAGAGCGAGAGACCTCGCT
CTTCAAACAACAAGCGATTGCAGAAGTGCAATCGCTGCCAGAAGTTGGGACACTACGCTTACGAGTGTAGTGCCCCACGCCCAGTACCAAACAATACTGA
GCGAAATGATCGGCTATTTGCCAAGAAGGACAATGGGCGTAGGTCCAACGCTGTTGCAAAACCGCAGCAGCGAAGCGGACCATCAAAAAATGGTCGGGGT
CAGTAGGGGCGGAGCGCCCTACTGATCCAGAAACCTCAAGATAATTTGTAAATCTCTTGACGAAAGTTGCTCCAGATACACAATCATTGTGTGTCTCCGC
ACCAGGTGATGAGATAGTTGCAAGTGACAAATGATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAACAACTTTGTTCGTCTTCAGTCGCTAGA
GGGTCGTAGGCTCAAGTTCGTTGAGCGCGACATCCCTCAACTGATGATGACGGTGTGCCTTGCCACAGGCGCGTCGATAACCGTTGAGAAACGTGTAGTT
GGAATCCACTACACGTTAGAGGGTGAACAGTACGATGATGATTTCATCGTACTGGATCTGGATGACAAATTTGATGTCATCCTGGGATTACCTTGGCTCA
CAAGTTACGAGCCAAGAGTGAACTAGCAGCATCGATCCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTGATGAACGTCATGGAGCGTCCACA
AGCGTGTGGATGTACTGCGAGTGAGTGCGATGGCCTCCCTTGCGGTACGGTCGTTAGCACGACTGCACAAGACCTCAGTGTAGCTGATCCCTACACTGTG
AAGCAAGCTCCCGGCGGCTGTACAGAAGTACAGGCAGCTCCGAAGGTCCACCACTCGAATAAGTCGAGTGGACCGGGACATGGATCCATGCCTAGCGGGC
AACATCCTAGGAAGAAGGGACCGGTTTCCACCAAAGGGCAACACGGTCATCCTAAGTCGACTGGAGAGTCGCATGTAGAGGATCGGTACCTGACTGTGGT
TGCACAGCCACAGTCAGAAGACGTCGAGGGAATAAGTCCCCACATACTTGAGGAAAAAATTCCTCAAGAAGTTATTGGTGAGGTAAAGAGACCTCATCAG
CCTGAGGGAATAAGTCCCCAGCAGCCTGTATTAAAGGTTCCCAGAAAGAAACCGAGACATTGAACGTCTTGGTCAATGACGGATCAAGCGTAGGCGCTTA
TACGCTTGATCTGGTTGTGCCTCCGAAGTTAACTTCAGAGATAACTCAGTTGCCAACGCTGGAAACGAAACGGTTCCTGCGTGATCTGCGTAGTGACAAA
GTCAAGCAGATCTGCATACTCGTCACAGAGGATGAGCATGTAGCCGATATTCGGTCGGAAACAGTATTTGATGAGAACGAACGGGTTCTCAGCAGCTCAT
CGATGCACGAAAGTGTCCTAGATGAGAAGACTCGGATTGAACGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTGTATAAGGATTTGAT
CGAATTCAAGGATATGTTCCCTGAATCCGTGCCATGCGAGTTGCCTAAGGACAAAGGCACTCGACACGAGATCGAGCTCAAATCGGGCTCGAAGTACGGT
GTCATGAAGCAGTGGCCACTGCCTCATGAACAAGTACTTGCGATCTACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAAATTCTC
CTCATAGCTCTTCGACCTTCTGTGTGCGCAAGGCCACAGGAAGATGGAAGATAGTGCACGCATTCAACAAGTTGAATGCTGCGACGGTACCGACTCAGAC
GCTGATATCGAGGAAGGAAGTAATCATTGATGGTATGTCAAAGAGTACCATCTTTTCGTCCACGGATTTGATGGATGGCTTCTATCATATCCTAATGCGT
GAACGGGACATCCCGTACACGACAGTAAGCACCCCGATTGGTATGCTCTAGGAGGGGCTAGTAATGCCACAGAGACTTAGCACCGCCCCTGCCACCTTCA
ACAGATGTGTTACAAATCTGTTGAGACCGGTGCAAGACTTTGCACCGAGTTACTTCGATTATGTATTCCTCCATAGCCGGACTACGCGCGGAAAGACGGA
CGTTGAGGTTCATGGAACTCACGTCCGCAAGACTCTTACACTTATGCGCGAGCATAAGTTGTACGCCAACCTCAAGAAGTATATATTCGCTGCAAGTGAA
ATACCACTTCTTGGGTGCATCGTTTGAAGAACGGAGTACGCCCTGATCAGGAAACGATCAATGTGATTACCGACTGGCCTGTGAAAGTCGATGTCAAGGA
ACTTCGAAAGTTCATTGGGATAGCGGCGTACTTGCACATTTAC