Description :
From Genome Similarity Track
Location :
Scaffold_18:2501297- 2503222
Sequence
1925 bases(100 bases per row)
ACACCACCGATGACGTCGGTGGGCGAGTTGGCCCCCGTGTCTTTGCGCGACTGTTTGTTTTCGTCTGCTTGCCTTGCGCACAGGCCAAACAGTTAATCGG
TTCTCGTCCGCCAGTAAGATCCCCGACGCCGAGCTCCTCGCCATGCGCAGGATCGTGTCGTAGTTGAGGTGCCCTAGTCTGCGGTGGAAGTTCATTAGCG
TACCAGTATGTACGTCGGGTCCCTTCTCGTCTTGGCTTTCCGCCAGCGGAGCCATGAGCACGCCCCTCGCGCTCTGCCGGCCGCTGTGGCCTCCGGTGCG
GACAACTAGTACGTTGTCGCATCTCTCCACGTCGAACACGGCCGGTCCGCCGCTCATCGCGGCTATCACGCGATTCGGGCCCCGATACTCAATCCTGTAG
CCCTTCTTTTCCAACCGCCCATACAAAATAATGTTTCTCTCCAAGTTCTTCGTGTACTCCACATCTAACAATAGCACCTTGGTCTGTTTCCCTATAGCCG
TGGTTTCCAGCATCACACTGCCACGCTTGGTTACTTTCAGTGCTCCTCCATTAGCGCCAACGCACTCGCTGTCAAAATCCTCGGCGTTCTCCAGCAGGCT
CTCATCGCTTACAAGGTGGCGTCCCGACCCAGTGTCGAGAATCCACACGCCCTTGTCGTTGATCGAGCTGACCATTGCCAAGACAGAATCGGCGTCGCCT
CGCCGACCGCCCTCTCTGAATCCGTCTGGGCACGATGTCTTTAGGTGACCCACCTTACCGCACTTAAAACACTTCCTCTTGTCCACGCGGGCTTCGCGTA
GATCGCTCACGACGTCGCGCCTCAGGTGTTTGCGACGTAGCTCTATCTCAGTCGACTGCGCGAAGTGAGCCAGCTCCTCCGCTTGCCGAAGGTAATCCGT
GCTTCCGAGGTTTAACCTCGATAACATTGACACTCTCATCGCAGGATCCGCGTAGTGCACGAGGCTGTCGAGGACCAAATTGTCGGTGCCTCCACACGCC
TCGCTGACGGCCACCAGATAAAGATAGTGCTCCGTCCAGCTACGCTTCGAGTCCTTCTGCGCTGTGAACATCTTCATGCTCTGCGCCGGCGTTATCTCGT
CGCGAAGGTGTGCAGCAGTCGCTGCATCGCGTGCTCCAACGTTGGTTCCTCGCCCCACCAGCCTTCAACCTGCTGGTTGTAGTACCGCTCGGCCATGCCG
GTGAGGTAGTGTCCGAGGATGTCCACCTTTACCTCCTCTGTTCATTCGAAACCGCTCGCGCACTCCGCGAACTGTATTTGCCGATCGAACCTCTTGCCCC
ACGACAAGAAACCGCTACCAAGACCTAGGTAGAACTCCTTGCCGTCGAAATGCCGAAGCTCGAGCTTTCGCTGACGCGTGTCAGGCACTCGATGGAACTA
GTTACCGGTGCATTCATTCCTTGCTTCACGACTGACGGTTGCACAGGTAGCTGGGGCTGCCGAGGTGGCACGTAATGCTCAGGTAGCGCTGGCTGCGGTG
CTTGTGTCACTCTACGTTCGCGGCTGCGTTCTCGTACCCGTACACACGCTGCTTCACGCCGAATTACGTGGCCGGGGATACTGTCGGGTTCCGCGGTGGC
GGCGTCTGGTCCAACGTCTGGTGATCCATCGCTCGTCCAAGCCCAATTGCAGAGCCGAAGACGCTTGACTCGCGATCCGAGAACCGGTCTATGTCCTCTT
GCCGCTGCTGCGAGGCTTCCAGGCGCTCCATGCGTCCCCGCCAAGTCCGTGTGCAGGCCCAGCAGCTTCTCCTGCGGGTCCTTGGGCTTGGACGGCGTTT
TGACTTCATCAACGTCTCCGTACTGGCCGTCGTCCCTCTCTTGGGCGATCTCCTTGGCTTCCGGAGCTCCAGGAGCTTTGCTCCCAGCAACGGTGTAAGC
TGTTGGGCTCATAACCGGTTAGTTT