Description :
From Genome Similarity Track
Location :
contig_9:250059- 253354
Transcript NameFunction/comments
g2244.t1hypothetical protein

Sequence
3295 bases(100 bases per row)
GTTCCTAAGAGCCGCAATCAGCTTACCGGAAATCAATACAGATGAAGGCCTCGAATAATGGTTACCTGGGGTTGTACAGTGGTTATAAAAACAGAAGAAG
TACCGTCGGTCTTGGTGTGATTCAGCATCGTTTGTAAGGCGCTTGTGTTTTATTTGCATGAACTCCAATTCACCATCGAGCCTGGAGAGCCAGAAAGCGC
AGTCGACATGAGGCGCGGCCCGAGATGTATCCCAAGCTGCATGAATGGTGCGACTGCAAGCCGCCAAAGACATTGAGCAGTGGCTCAAAATCGGAGAGAG
ACGTGCATTTCGGGGTGGCCAGTACTTGGGAACTACAACGTGGTGGCATCGGAGAGTTGTACAACCCCAGCGATGACGCGGCTGATAATGACTATTTTGA
GTCGTAATGGTGAAACGGATGTTTGCTTGAGGGGTGTTCAATGCCAGTAATGGGCACCGCGGCAAGCAACCGCCCATGTCTGAGGTGGCTGCATGACATC
CTGACAGCGAACGCACAATATATTCAGAGATTGACAGTACTTTGGCTGATAGTAATTTATTCTACGAACTACTAACAATCTAATATTATAAAGCCATAGT
AGATATAGTTTCAGATCGACCCAAATATATACTATTATAGTAGCTAGTAAAACGAATTGTGATTAATATCGGTACTATCTGATTACTAGGATTGGCCAAT
GCAAGCGTTCGATGAAATCGATGCGGCTTAAGAGAGAGGCAATAAGTGCGAACGTTGTTGCTGATGCCGTGGGAAGCACTAAACGAGCGAGTGGTTCGTC
GCACTGGACCACTTAAGCAGTATTCCGTATCTTGCAAGCGGTTAGTGGCACAGGACCGCTTGAGCAGGATTTCTCACCGAAGACAGCGCGGTTCGGCTAG
CTTATCGGCTCATTCTGCGATTTTCCAACAGCCAAGAACTTCTCCTCACTCTTCCTTCTCAGTCACGCCCTTCATGAAGTGCGCCAACTCCGACTGTTCG
TACGCCGAGCTGACCACGACGGACCCGTGTGTGGCTTGTGGCCATGGTGTTCACTCAACAAACAAGACGAAGACAAAGGACGGCTTCACCCCTGTGCTGC
TAATTCGACGTAAGCTTGTAAATACGACCATGTCGCCATCTCAATTCCGTGATCACGACTTAGCCACAGTTCTTTCTAGATCAGCGGAAGATAATATCGT
CCTATGGATTAATACTTTTCGAAAAAAGATGCACCAGTGACTAGAACAATGCTGAAGGTAAAATGTAACGGGGTACACCGACGTGTACCTATGTCCATAT
AGAGTGACGGGATGTTCCTCTTTAACGTCCATGGTACGTGGTACCACTTGGTGGTGAGTCATCCATTGGGCACTTGTTTAGCTTTTACTATAGTTGACTT
AGAGTTTGTAAGAATCAAGCTTGGCTCACCTATAAAAAATATTCAGTCTTTAAACTACCGTCTAAATGTAGTCGAATCCCTCAGGCCGGGAACCGTGAAG
TTGTTGTTCACCTAGACCTTACGCTCTCTAGCGCTTCTCTGTGCAAGGTGTTGTGTGCGCCGTCACATAAAGGTAAGGACATCGCAGAAGAGTATGGTTT
AGAGGAAGATCAGCTCGCGGTATCGGCAACGTGGATGACTTTATTCATGCGACAACACAAGTTGTCGCTTCGACAAAACCACGGCACGGGCAGACAACAC
CCGAAGATGCAGCTGAAGCTGGTCGAGCAACCGAGAAGAGGTGATGCAGATGGTTGTCTGGCTCAACTGCGTACAGTTGTTAATGCAGATCTGACAGGTA
AAATATGCAAGGAAATACAAGTTTTGTTTGTGATGCATGCTAATCATTTCTTTATAATTTTTTTTTTAATGATTTTTCTTTTAAGCTGTATTTTTCGAGT
ACGTACCAAACGAACGATCAACACTTTGGGCTCCAAGACTGCGTCGGTCAGGTGGTAATAAAGACACACAACGGGCGACAGCAATGCTGCTTGGCGATTC
CAGTGGCAATAAGTTCGACCCATTCATTCTGTTTATGTAGCGGGGCTACATAGTCGGTTCACCTCCTACCTTAGTGCAACACGCACTAATGGATACATTC
AGGTTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAGACATATGACTGGTAGAAAGCAACATATTTCTACCAATAATAGTAATTCATTAGATAGGG
ATTCTGCCAGTCATCCGATGGCAGAACCCTCATTAAAAATATCAGTTTGAGGAGGAAACTCAGTTAACATTCAATACCGTTCTCATTTAGCACCAAAGCT
ACGTTCGGTCCCTTTATCTATGTTTAAGTATACTTGTGACACAAGCATACTGAATATAAGTTACATACTCCTGCGCTTCCTCATACAAGTGCTCACACGT
GTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACAGTTTAAGAGTACTCCCATGATTGCACTTCAATACGCACGCTGGCTGTATCACAATCACAATTG
CATCGAAACCGTACCGAAGGTTGCACTCACAAAACCCTAGACAAATACGCCGCGGGAGGAGGTTATCTACACGGGGTCGAATGGCTTTACAAACACCGCT
CCGAGAGCTTTTCAGCTGCAGTCATGGTTGGCGCTGCAGAATACAACCACTTGGAAGTTCTACTGTTCTTTCACTTCTAAGGCTTCGCAAAATGCACGGC
GGAAACGCAGGCTACAGCACGTGAATACGTGGTCCCTGAGATGCAAGCCTGGATCCACAAGAACTACCCACAGTTGTTTACCCCAGGCGCTCGATTGTGA
TATATACCACATCAAGGACAAGGTGCTACGCTGACTAAGCATCAATTTGTCGGCTTCGTCAACTTTCATAATTGGTACTCGAGCGACAATCGGAAACGTC
GAAATCAATTTTATAGCAATTTTGTTAAAGCATTCATGTAAAACACCACTAACGCAATGGCGTGTGTCAGCCCAACAAAGCCATTGTGGTGATCCTGGGC
TCACCGAGGTTATTCGTGAATTCGCGGTGTGCTTGAAGAGGAATTTGGATGTCGCCGCAAGAATCTCTCTCTTTTTGGACAATGTAGTGAAGTTGACTAT
GCCCAAATCGTGTGCAGTTGGATCTGTGAAGCTACTGAGACGATTCTGGTAGGGCGACCACGTGCAGGTGGAGAATGGTGCAACATATTAGACACTTAGG
TAAATATGTCTACTCGGATCGACACTATCACCCGGTTTGATGGAAGCTCTGGAGGTTTTGTGTGATAACGAAAGTGGATTGTTGGAGGACCGTGA