Description :
From Genome Similarity Track
Location :
Scaffold_166:25004- 27284
Transcript NameFunction/comments
Albla_Nc14088850

Sequence
2280 bases(100 bases per row)
TGCATTACACATCAGCAAAAATAAAATTCAGCTTTTTCTTTTATCTGCAATATTGAACCAACATTTTAAAGTCCGAAAATTGAAGAATTGCTCCAAAAAT
ACAAAACTGACTGCTCTTACAAATCAGATTAGGTATGAACTTTGGAAAAAGAAGCAAGAAAATCCCAACTTTAGTCAAAGTCAGCTTTCACGTTGGTTGA
AAGAAAGCTATGATATGTCAGTCGGCCAAGTGACAGTATCGAATATCCTCAAGGGATCCAGTGAATTCTCTCACAGCCTGGAAGGATCAATCCAAATTCA
ATGCGGCAAAGAAAAACAAAGTTTCCTTCAATGGAGACAGCATTGATTGAATGGCTTCAACTTTATGAAGAAACGATTCCCATGTCCGGAGACATTATTA
AACAAAAAGGGAGTTTCTTTTTGGGTCGTCTTTATCCAAACGAAAGCTTTAACTTTTCAAATGGATGGTTGCAATCATCCAAAAACAGGCACCATATTTC
TTCAACCAGACGTTTTGGGGAGTGGGTCTGTTGATATGGATGCTCTTGCTTTAGCTTTACCCTCTATTCAAGCAAAACTTGATACGTTTAATCTCACAGA
CATCTACAACATGGATGAAACTTGTTTGCAGTATCGTATGTTACCAGATCACTCATTGTCCTCCCGTCAACTTGAAGTTCGCAAGCAAGGGAAGGAACGG
CTCAGCGCAGTTATCTGTGCAAATGGTGATGGAAGGGACAATCTACCACTTTGGATCATTGGTAAATTTGGAAAACCACGCTGCTTCAAAAACATTGATC
TGAACAGTCGTAACTTCAAATACAGGGCCAAAAAATTATCCTGGATGACTATTGCTTACTTTGAAGAATGGTTGAGATGGCTCAACTCAAAAATGCAGGG
AAGAAAAATTCTTCTGATATTGGACAATTGTCCTGCGCACACAAAGCTGAAAAATATGCCTCTTCTTTCAAATACTGAAGTATTTTATCTACCTCCAAAT
ACCACATCTAAACTTCAGCCTTGTGGTGCTGGTATTAATCGTTCTTTCAAAGCATATTATCGTCGGAATTTTCATCAACGGCTACTGCAAAGTATTGAGA
ATGGCATTGTGGACCCAATGAAAGTTGACTTGCTTCAGGAATCAAAATGTGTATTGAATCCTGGGGAAATGACAAAGCATCCACATTCGCAACTATTTTC
AGCACTGCAACATTAGAACTCGTTTAATAAGTATAAACTAGATGATCAACCTTCGCAATTCCCATTCAGCAACCTTATGGATATCAACTCTCTTCTCAAA
CATCCATTCGAAAGAGAGCCACATATCCCCCCACTGATGATGAAATTATACAACAAGTTAATGTGCAAGAACAGGAGAATCTTTCATCCGAGAAGATGGA
TGACTGCAACGAATCCCAAAACGTATCCCATTCGGAAGCTCCCAAACTGTTTGATTTTATTGAGTTTTCTCTTCTTCAACAGAATACTAATCAAATGGAG
AATATTGCAAAAGTTCAAAGCTTGAAAGAAGCTTTCACTTCAGCTCACGAATCATCTCTTGCTCAAATAACTTCCGATAAATATTTTTCATGATTTAGCA
TATGTTTTTATACAGTTTGCTCAGTTGAAATTATCTGTCTAAATTGATCACACTATGGTATTTCTACTCAGGTAATGTGTCTTGCAAGAAAGAGAGTCAG
CACGTGATATTTGCATCATTCGTGTGGTGTTGCGAAATTGTAAAGTGTCGAAAGGACTCAAGGGTACCGCGAAGTGTAGAAAGAACTTAAGGTTAGGCAC
TAGGTTCTAGTCGCACTTGGCACTTAGGCTAAACGGCTGGCTAGGGGTACCGCGAAGTGTTGGAAAAAGGCGAAGTTTTTCAAAAATAAGAACTATTATA
AAATACAGTTTGTCAATTTTCTCTTTCCGCAAACATCTTCGCTCACCTACCAACATAAACTTCATTCGGAAGGATCTCCAGTTTGTAGCCATCACGGTTG
AAAGTTTCATAACTTAAAGAATGCTTGGGACTGAAGAAAATTTATACAGTAACGCAAACTTTCAGTTTAATGCACACGACCAGTTTAGTGCACTCAAATG
TTTTTGTCCAATACTATAAGCAAGAAAACAATTAAGTGTTTTGATTGGATAAAATATCAATTGTGACGGAAAACGCCCATCCTTCAATAAGTTATGACCC
TCTACGAATGATTGTATGCAGTTCAAAGTTCAAAGCGCAGCTGAGCTCTACAGAGAAAGGAAAGAAGAGGAAGACTATTG