Description :
From Genome Similarity Track
Location :
Scaffold_185:25000- 26104
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_185-snap-gene-0.20Adherance factor

Sequence
1104 bases(100 bases per row)
CACCATCGGCTTGTGGGCGGCGTAGGACGAGTACCGGAGGTAGACTGACTTGTGCGGGTGCTCAGGCGTGGGCTTCTCCAACGCACCGAGCACGCGCGCC
TCCAACACATTGCTATGCAGGACACGGTCGTTCTTGAGCATCGTCTTGTCATCGGCCATGGCGAAGAGCTGCATGATGTCTTCGACTCGTGCACTGGTCT
CACTCACGCAGCAGAAGCGGGTCTGGTCAAAGCGGGCGAAGTTGTCGACGTAGTACGAAACGTCCTTCTTGACGCCCTTGGGCTGCCAGTTTGCTCGCAT
CGGGTGGTCGCCCAAGGTGGAGCTGAGTACGTCATTGACTGTTGTGTTGATCTCTGTGAGCAGCTGACGCTCCCTCAGCGGTGAGAGCTGCAGCAGCGAT
CCTCCCTCAGACAGGCGATAGCTGCGCAGGCGGCGAGTGCCATCCGCTAGGGACGTCTCGCTCTCAGTGCTCGCGAGCGACCACGCAGACGACGATGTCG
CTGAACATTGGGAGGAAGCGAAGGGGGACATTGGTGGCATATTTGTAGTGTGAGCTGCTTTCGACGTATTTGGGAATGAACGATCACGGCGTGATGGAAA
ACATGGAACGATAAGCTCTCGCTATGAGAATACCGAAGGGATACGGGGCGAACGCTCAGCAAACCCATGCAGAAAACGGATGTATTTTCTTTCTCGACGA
TCATTCCCAGCCAGATATCAGAGCTCCTGCCGGTCGGCACGAAACTCGTGCCGNNNNNNNNNNTCCACAGCCAGGACTGCACGAAATCGTCGAGTCTATT
TTATCAAAACACGTTATATATCATATATTTACAGTAAAGTTTTCTAGAGTTGATATACCTTGTTCTGTGCATATTATGACGGGTCTCATCCTATTCTGGG
TGANNNNNNNNNNTAGTTTTCTAGAGTTGATGTACCTTGTTCTGTGCATGTTATGACTGGTCTCATCCTATTCTGGGTGATCCGATATTTCAAGTGTCTC
CTTGATTCGAACATCTATGGCCGGCCTTTCCATACGCGGAGCCGGCAGCCGGCAGACGATGCTGACAGATCTGGACAGCACATGGCGTCAGTTTCCTCCA
CACG