Description :
From Genome Similarity Track
Location :
Scaffold_183:250- 9761
Transcript NameFunction/comments
Phyag_g3178hypothetical protein PHYSODRAFT_561460
Phyag_g3179hypothetical protein
Phyag_g3180hypothetical protein PHYSODRAFT_509106
Phyag_g3181hypothetical protein

Sequence
9511 bases(100 bases per row)
GGATTGTTGTGGTTGTGGACGAGTGTGTGCTCACTTGATCGGGAGAGACCGATCATTCCTTCCTGGCTTTCATTATGCTTCTTGGCTCCCTACGTCGAAA
TGGAGCTGATCTGCAGCGATGGTCCTGCAGATTCCAGCTCGATTCCTAGTCACCTTGGGATCGTGCAGAGCTTCTTGTAGCCCATCAGGTATCGGCCGAA
AGGTTGAATAGTAGTGGCAAGTCAAGTaaagtttttttttacgGTATGAGTGTTCATGCAAAACGcatcctccacctcctgccaCTTCATTCAAAATAGT
GAACGACTTTTTAGATTACGAAAATtatggaggtggacgaagtATTTCTTTGGGACTCAAGTGACGAGTTCGGCACGGAAGTCTGGTCTAGATGTCATGG
GATCGGCTGACGAGGTTGAGGTGGGGGCGATCGGTTCTGCTAGGAGCATGGAATGTGTTGTGTCATGCGGCACAGTCTCGCTGGACCAATCGGCTTCAAA
CGCCAGGTTGGACAGCGACGCCTTGaggtcctcctcgtcgtcgctggtctCCTCGATCCCGACGTCTTCTAGGCTATGGGTCATCGCAATTTTGGGTCGG
CGGTGCTTTAGCTCTAACGGCACGATGGACGTGAAGCTCGTCGGGGACAGGCAGCTATTTTCAAACTCCAGAAAcatcaagtcgtcgtcgtcttcggcag
GCAACGGCGCAATTGAGAGCGAGGCGATACCTGCGGCCAACGATGAGCCGGTACTTTCCGGCGGATTCCTCAACACGGAGCTGAATTCGTCCTCGGAGAG
CACAAAACTGGATGAGTCTGCGAAGTGGCCTAGCGGGTTGCTGAGACTGCGAATGGTGTCGATGCAGCGCATCATCCGCAGAGTGAGTGGAATTGTCGAA
AGGTGGATCCACAACTGCGTGCGTGGGTTGCTCGGGAGTCTCACCACCATGCGCATCTGCTGCGCCGCATTGAACGCCActccgttgctgcagcgttgct
gcGCTCGTAGAAAATCCTCGAGTTTTTCTGCATCTCCGAGCGTcaggaactggagcaggTTGCCGCCGTAGAGATCTGCCGCATTGTCAGCACCGAACTC
AGGCGCACACGTGTCTGCCACGAAGATGAATTCGCCCGATGGTAGACAGTAGGCGATCCGCTTGCCACTCGGCACGTCGTTGATCTCCAACAGCGTGACG
GTGCCCAGCCCCATGGTCGAGTCGAATCAAGTGAACtgagtgacgacgacgtccgtTCTCTCCGAGATGAGATTGACCGGTGTGGTGCTACGCGGCACTT
GGGAAGTGACAACCTCCGGCCCGAATCTGAGCGTAGCACGACAGTCGTGTGTGGTACGTTTCGGGGTAGATGAAGTGCGCGATGAGTATCGGAAAGTGAC
CGAGCGAGCGGATCGAATCGAGCTGCGAAGCCAGTATAAGAACCGGCAGAGAGCTGATTGACAGACAGCGCTCTCGCTAATGATAGCTCCGGACGGCTCA
ACTTGACACCCCCGAGCGGATCTGCTAATGCGTGGGGGGTTCGGCTGGGTTTGGGCGATGAGAGCGTGGAGGACGACCGATCGGCTATCGCTCAGTCGCT
GGAAAACTTGAGCCGAGGTCTCGGTTGCTTGCTCGGTTGGCTATCTGGTTGCACCCGTTACCGACGGCCTGTTTGGTCAATCTGCCGATGCAACAATGCC
AAGTTGATGGAACCATCTCGGATCCTCGGCAGACAACGCGAAAGACGAACCAGATTTTGCGTGTTGCTATTGACGCTGGCGCCCTGTCAATCGCGATGGC
AGCGAGAGTACCGGGGTATATTGTTCGCAAGACGCGCGACTACATAGCATTGCTGTTTATAGCTGCGTTGCGGAGACCATCGGGCTTGTCAGGGGTTGAA
AGGATGGCAGGCGTCGCAGGTCGCTGTTGAACTTGCCCCGCAAGTTGCCCTAACCAAGACTGACGTGCTTTTGGTACCATGTACCCTTCAAGTTGCCTcg
gattggctgaaaaggCGTGGCCAGCCACTTGAACGAGCAGTTCAACCACCATGCCGTCGGATGAGGAAGCACCACCCGTTCCGCTGGATGACTACGAATA
CCCCGTCGTACTGGGCGACTCACTgaacgacgccgacgagcaacagcagagcgacgacgtgtttgCGTCCTTCGGGTATGAGTTCCAGCCCGCGTCCGTG
GACAAGAGCACGCCTGGACTTGTTAGTGTGGATGGCTCCAGTGGCGTGCAGGTGCTCATGGGCTCGTCCACCGGTGCGGCTGGAGGCGTGAGTTTCAAGG
GGAAGCTAGTGGAGCACAAGGAAACCGACTGCCTGCTGATCTTCGACGGGTCTGGCTTCCGTCTCGAACGGTGCCCGTTCTCCTGCATGCAGCTGCGGCA
CGTGCGTGCCCCCACGCTGCGCCGCCATGTTAAAATCCAACCTGCAAGCAGTGGCATCGCTGCAGAGACTGTGTCTGGATTGAAGGAGCCGAgcacgcca
gcagcggcggcgatAGGATCAGccaggacgacgaagagagctgcaggtggtAAGCGGCCTGTTGGGAGACCAAAACAAAACGCaactgcgactgcgacgg
TGAAGCGACCTAGAGGCAGGCCGAAAGGCTCGACCAAGGCGGCAATTGCAGCCAAGAAAGCGCGGCTAGAGGCTGAAGCAAAAGGAGACGCGTGAATGAG
TTGATTGCTGCGCCCTGCTCACCAATGCTCGACAATCGCTCTCGAGACACTTCATATTTTGTGTAACTCCGTTTTGGTATCTTCCTACTGCGCAAGGAAT
GCTTATGGGAGGTGTCGATGGGAGGTGTCGATGGGAGGTGTTGTAACTTGCCCAGGTTGCTTTAGAAAGTTGCTTCAACGTCCCAGATGATCGATCGACA
TTGTGTACGCCACACTAAATTATTTTGAAAAGACACATAAACCTGAGAACGAATTGGGGGTGCTTCTGTTCATACAAACAGCAAGTTAATTCAGGTAGGT
GCGACCTCTAGTGTTGGGGTATTTGGAGCTTCTCTCTCTTCAAGTGTCAAGAACAGCGGCTGCTTCATCCCGAAGAACGATCGCATCGTGGAAAAGCCCC
AGCAGTCTCGACAACCAAGGAAGCAAGCCTTCCAGCCCACCGCAGACGCCACCCGAACAACTGCAAGCATGAGCAAAGGCAACAAGCGCCGCGAGACGGA
CGTCATGAAGCTGTACACGAAGTCTCCGATAATGACACAAAGGCGAGTGTCTTCCTAACTTGTCCATTTTTGCACTGCATTTTTGCACTGCATTTTTGCA
GCATGATGAGCGACTACGAGGTGCATCTGACGGACGAGACCAAGACCAGCGACCTCGACGTCAAGTTCCACGGCCCGAAAGACAGTGCGTTCTGTAGGCA
GCTCTGCTCCCCTGGAGTCTTCTCTCTATTGACAACGTTTCTGACTCTTTTGTGTGTGTGAGAAGCCCCGTACGAAGGGGGCTCCTGGAAGATCCACGTG
ACGCTGCCCAAAGACTACCCGTTCAAATCGCCGTCTATCGGCTTTGTGAACCGCATCTACCATCCCAATGTGGACGAAACGTAAGATCACTGTTATGTTA
TAAGTATAATTTCTGTGAGGAGTATGACTGACTGTTGTTGTGCTTCTGGATATTGTAGGTCGGGATCTGTGTGTCTGGACGTGATCAACCAAACGTGGAG
CCCGATGTTCGGTAATAATGATTGCTGAGGTGTTTGAAGCAGGATTCTGACACTGGGGTGttgtgtttttttttttcagaGCTGGTCAACATTTTCGACA
TGTTCATCCCACAACTGCTCCGATACCCGAACCCAAGCGACCCGCTGAACGGTGAGGCTGCATCACTGCTCATGAAGGACGCTGAGTCGTACAATAGAAA
AGTGAAAGGTGTGGAACGCATGCTGGCAATTGTATCTAAGTGAGTCGGTGAACTGACAGGTTTTATTTGGTTGATCATGCAGAGTATGTGCGCAACTACG
CCTCGCAGCCCATTGAAATGGgcaacgaggaagaggacaGTGATGTCAGTGACATGAGCGACATTGAGTAGCTTGTTTCGCTCACTCAACAGTAGATCGG
CCAATCTGGTGAAGGCTGCTTGGATCTTTGACACCTTCTCGTGATGCCACTGCCACGCCACCCAGATTTTATCATGTCGCCCCACTGCATGTTCGCAATG
TTTCATTCCGTTATTCCTCTCGATGTCGTAACCAAAAGAAAGGAATGGCACTTCATTGTTTTCGTTCGTTTAGAGGCTGTGCTGTCGAAAGTGCTTCCAT
GCATGCTTACTTCGAGAGGAAGTTGGAGGCATCAGCTTTTCTTTGAATGTAATGTGCGTTTCTGCGAAGTCGATCACTCATGTTGCTCTCGTCATCCAGG
TATGCCTCGGAGTGGAGTTTCCTACATCGTAACAAATAATTAGTCGATAGCAGGGAATTATCACAGCAAAATCCAACACATTACCTGAGAAACTCGGggt
tgctgcttgaagccTCTTGTTCGCGcttgtccagctcgtcttTCTTCAAGGTCGCGCGTTTAGCAATGTATTCATCACGCTGCTTGGCATCGTCGACCAT
CTGCCGAGCCATACGCTTCCTGTCCTCCTCTGTCAATACACGGGATTCTCCACGAGACGACTTGCCTAGCTTGCGACGGcgctcctcttcgtcaagGCGT
TTAGCCTCTCGAGCTTTCGCCAAGTACTTTGCGTTGGGGCCCAATGACGTCTTATCAACATCTTTGGATTCCACCGCACCCGCTTTGCTAATGAGACCAT
ATTTCCCCTCGGTGTCCAAGGGTTTCCGCCTTGATTCTGTTTCCTTGCGACGGTGATCATCATGACGATCGTCAGAAGATTCTCTTGTTCGTTCACGGGA
AGAGCTTCGGTGGCGACCGTGACGCTCGTGACGCGAACTCTCGCGTCTCGAACGGGATCGATCGTGCTGTTTATCGTGTCTCCGATCTGGGCTACGAGAA
CGATACCTATCTCGGTCCTCGTGGCGTGCGCTTGTACCCTGGCTACGCTCTCGTCTGGGTGGCGTTCTGCTACGACGATCCATTGAGTGGCGAGTGGAAC
GCATATCACGCCCAAAGTCATCACGACTGCGGGATCTACGCTCCAGTCTCGAAGGTGTCCTCTCTCGTTCACGCCCATGACCATGTCCATGATGGTGCTT
GGAAGGATAGTTCTTATGACGACGatccgccttctcctcctcttcatcccTACTAACATCACTgtcttcactgtcgtcaCCACTATGtttccttttcttc
ttcagtcggCGTTTCTCCTCTCTCCGTGCAtgctttttctccttcttcgcagccttcttggctttcttgcgagccttcttgtcctccttcaGACGATCGA
CCTCAGCCTTGATCTTGTTCATCTTCACTGGGTTCTTCAAAATCTGTTCACGAGCCGCCTGCTGCCTCTTGCGGATGAGCATCATCGGGTCCTCATTGAG
TCGTTGGAAAGCGTCGTTCGCCGGCAGTGCTGCTTTGGCCATGGCCAAAGAGCCATACTTGGTAGTAGTGCTCAAGTCCACATCCCCTTTCGCCGCCTTC
TCATCTTCGCCCTTGTACTCTTTGCCCAGTAAATActcctccgccgtcttctccccagcagcagacggccCTTCGTACATCCAGTCAACTCGCTCTACAG
CCGCGGACTTATCACCACGGGCCGCCTGCAGCTGAcgaagctcctgcagctgccgctccTCCTCGATGTTCTTGCGTAGTTCCGcaactttcttctcctc
tgcCGCGTGCTTCTGCTCGGCGATCCAGACCTTCTCCACATTCTACAGACAATAGAAATATAATAACGAGGTCAGTTTTTACGCTCTTTTCTGCGTCAAA
AGAGACAAATGGGGGCACATTCGGCACACGAAAACACGGAGAATAAACAGCAGCGTAGATATGGAGCAGAATATCGCTCTACGTACACGTAAATTGGCTG
TAtgccagctcttcttggacAGGAAGGCTAACGACATCGCTGCTCGCCGCTTTGGATGGAAAAATTTACTCGTACTTAAACGAAAACATTTTTTAATTGA
TGTGGTTCACAGATGTTTGCATTTGGCTTCAACATCGACGTACACTCCTCTTCATGGAAGGTCGCGGacacgaagatgccgccgctGTGCGTCGCTCCGG
CGCGTTCTCAGGGCGACAGGTGACTCTGGAGATGGGCAAAGTACGTGTCGGAGGCTCCGGAAGACCTATACCAGCTGTATTCTCTACGTCGGCTCCAAAA
CGCGCTGTAACTTCATCACTAGAGGCGCCATCCGCCGCTCGATCACCTCGCGTGACCTTAGAAGTGGGTGATTTAGCTTGCATTTTGGGTCCTTATTTGG
GTTTAAAGTGATTAtcgttggtggtgttgggtGATTTGGTTGCAGCCTCACCCGCGGAGTCCCTTCCGACGGAAGGAGGAGTTTTCGCAGGTATTCAGGA
GGGGGGTTAACGCTTTGCGGTGCTTGTTTTGGGAGTTATTGACTTGATATTATTATTTGTTGTTGACCAGGAAGATGTGGTAGCAATCACATCGAAAGAG
ATGGAGGTCCAGTCCAATTCAGAGAAACCCCGACCTTCTGGCTGTGGTCACGGTCGAAACACCATGACACTACCTACTGCTAGTGCTGGTGCAGGCACGT
TCGTGTCGAATATGTCCTCTCTCACCAAGTTACAATGTTCTTTTACTGCTAGAGAGCTGGAATTGTTCACGCACCGATTACAGACAACAGAATCAGAGGG
AAATACGCGACCACGGTATCATGTAGCTTCGCACCCGCATTCGACAGCGGCGGCTACTAGTACTCAGCTTTGCCAAGCACATGCGGGAAACATAGAAAGA
GATACTACTCAGAAGCGGTCATTGCTATCACCTGCTTGTCGGCACAACTCTGGCAGTTTTATGTCAAACACACATCGCGAGGTGGAGTCGTCGTGGAAAC
AAGTGGATACGTCAATTGATCATATTTATGAAGACCCGTCGATTGATTTGGTGCAGTTACACTTACTACACAGTCATCACACAGCTAGTGGTCAGAAGAA
AAGGAAAATGGTGGAGCGTCAGCGCGTACTTGCTGCCGCGTCTGGGCTTCGACAACATCAGagcgaagagcagcaacgccaagaacaGTTACAGCAGCGt
aagttgcagcttcaacggaTGTCGGAAGCAATTCGACTACAAAACCAAAGAGCTGTTCGTGTGAGGGCAGCACGTTCAGCCGGATTGAACGAGCGACCAC
TCAAACCTAATCGACCTACTAAAAGTGCGCCAATGCTGCCGGAACGAAAGCCGCCGGTGCCGCGTTTGAGCCATAACAGCAACTCATCGAGACAAATACG
GCCAAAACGGAAAAGTAAGCCGAAGAATGAGGCATCTCGGCCTCAAGGAGGCGTTAGTACGTCTATACTCATGGATATGCCATTAGACTCGAACGTTACA
ACTAATCAGCAAGAAGCCGAAAGTGATGCGAAAGATGCTAGTTCTGATCAAGAGACCACTAAGCCACTTGCGGAGGAAGTAAAAAGGATacctccagcga
cgacaccgcgtgcatcgaagaagaagcgcgggGGGACTACCCATTCACCTGAGGTCGACGCTGCAACCCAGGCAAGAGAAGAACGGCGAGCAATAGCTCG
TGAATACATGCAATTGCAGAAGCAAAGTCGGCGAATTTGGAGTAAAAAGGCAAAAGAGCAAGCACATCACGAGCAAGAAAAACGACAGCAGAAACTTGAG
GTAAGCTAAGGTCATTGTTTAGGGTACGTATTCATTGATAGTCGACTAACTATGTAAATGGTATCCCAAAATGTTGCGTTCCAGATATTAGAGGCCACTC
GACTAAAGAATTTACGCCTCTCTAAAAAGAGAATGAATGCTcgcaagaagcacgagaTCGATGATCCTGCGTTTTTGGATGACTTACCATCTATGGCTAT
TGCTGTGGGTGCTGTCCCACGTACTATTCCGGACTTCAGCATCGATAAAGCATCCGTCACATCCGTGAAAGTGTCAAAAGGAAGCGCTCGTGCCAAGGAA
TTGGCTCTTGATCATCCTGACTTGGACGATGAAAATGATCAAGCGATTGCAAATGGGTTAGATCTTGAGTTTTCATTGCACTACGAGACGGGATCGACAA
ACTCCAGCGCAAAACCAAGTAGTACCTCAATTTCACAACAGGTAACGAATCAAAATGCTGAACCTGACGAGCGTGTTCGCAAGTTGCTCGAGCTGAGAGA
AAAGGCGTCGGCTCTTTCGGCTCGGTTGAGTGGCTTACGGAACCGAGTAGACAATTCCAAGACTGGAACGGTGGAGAATGATGGTTTGGATCTCAAAGCG
AATACAACGATCACAGTTGCTAATGACCCACTTGATATCCCAATTCACGACACAGAAAGAAGCGGACTGGTTAACTCAAAAATTGATCATCGTAGCTCTG
AGCACGAAAGCGACCAAACGGCAAAACAAATCGAAGGTGATGataacagcagcacaagtgaAAGGAGAAGCGAAGGAGCATTTAGCATTGGTCGTGATTA
TCCCAACGATCACAACAGCACCGAAGGGACGGATCCGGTGGAAATTacaccaagcagcatcgCGGATAAGGAACACGTACCTGTAAGCATCACGAATAGC
CTACGGGTtgtacagcaacaccagTCATCCATCGACGCAGAAGATGCTAATGGAATGTACGATGGCAATGCTGATAAGGACATCGATGTCCGAGAAATTG
GCGTTTACAGCATTGGAGTTGTGTggccactgcaacatcaaGAGGCGGTGGCACCTAGCGAACGCGAAACACAACAAACTGTGAGTTCGCCATTGGGAGG
TTCGTCCAGTTTATCATCGTCGGCTGGGTTGTCACCTCAAGGTTCTACTACGCTTTCACGAAGAGATGAATGGCCTAGAGATTTTGATGAAAGCAACAAT
GAATCGAAGAGGAATCATGATAATGTCTTTGAGCTTACATTTTatgagaagatgaagaatAAACTGCAGACGACTTCAGCTTTGTCCGCTGGTGAGGTGG
ATGAAGCCACGACTCCGTTGTATCATGAGGAAAGGCAAGATGAAACAAGGAAGAGCGATTCAGGTTCAGATTCCGAGTCCGATTTGGGGAGTTTTCGGGT
GCACGCCTCACACAAAAAATATTTGAGTGCTGATCGAGGTGTTATGCAAGGATGTGGAAACAGTGGTAAAACCAGCCCACCAAATGAAGGCTTGGTGCGA
CTTATTCGAGAGACCGACGACTCATTAAGTGTAATCGATCGTGTAGCGAAAAAGCTCTATCACAAACAGCGCGAGCGATCAGAACGTGAAAAGGAAAACC
TACTACAGGAGCGAATTGCAGCAGAAAAGAAGGAGTTGCTCGAGAAGGATATGGTGCTAAAGGCTGTAATGGCTACTGTAACAGGCAAGATCTTGGATAG
GGAAGACCCCG