Description :
From Genome Similarity Track
Location :
Scaffold_936:250- 6345
Sequence
6095 bases(100 bases per row)
CTTCCTCCTAATCCACCATTCCCTTGTGGATTCGTCTTCTCCTTCTTCCCGATGTAATCAACTCACATCAGCGATCCTCCCCCTCCTGGCCCACACCCTT
CCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCTTCCCTACTCTTCTTCCTGAGACTGCATCACGCCGAATCTGTT
ACGGTTCGTACGATCCCTCACAAAATTTTAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCAACCCAACTGGGTTCGTCATATCCACGCTAATACACC
AGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCC
AACTATCTTTCGGTAGGAGGACTTACGCGTGGGAACACCCCGACTACCTCGAATTGCTAGGCAGCAATGAAGGCAACTAAAAACTGGGCTAAATCCACAC
AAAAAACTCTTTTGCTACTTTTCAAATTACTCCGCCTTAGGTTTCGCCGTTGACGAGTCCATTTCATTGTCTTTTGTGGCCTTCATGTACTTAAGCAGCA
AGTACCAGTTTATGATAAACAGCACCAGCACAATGACAACAACGGGGGCAGAGCGCCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATC
TGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTACCGTTTCCAGCTTTACCGCGT
GTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACCCGATCCAAATAAAGCCACACCTG
CGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCT
TGCTGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCCAGGGTGGATTTGG
GATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTCGCGAAAGGAAGCCGCTCTGCGTACTCATCCCAATCCTTC
TGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGATGATATGCCATAGTTGCTC
GCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCG
GAAAACGCACTCCTCGTACGATTCACCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTACACCCAAATCAAC
AATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGGTTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACCCCC
TTCGATTGTGGGCCTGCCCTTGCCTGTCTCGCAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGG
ATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGCGAAAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTC
TCATCAATCCATCCCGATCCTCGTTGACTCTATTCGTAGGGCGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTA
GGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAAGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGC
TCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGGCCTAGTGACGGCCATCACCTGGACTGTCCTTT
TTTCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAGCGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAA
AGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAGCTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGC
CGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTAATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTT
GTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCA
TCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGT
ACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGAAGCGACCCTAGTCAGCGCCTCATCCATCTTAGATCGAGGAGTGATGCTCGCGG
CCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAA
CCCGGCTGACTTGAATAGCCAGGCTAACGTAGAGTGTCGAGTCAGAATCCGGATGGATCTTCCCACTAGCAGGTTGTAAATCAGATCCAACACGCGCAGG
AGCGCGAGTATCTCTTTCTCCACTGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTT
GAACCAGAGCTGCTGAGACTGCCCAGTCACTGGTATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATCCT
GTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGGTCCTCTCTC
CGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTT
GTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAA
CCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCGTCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAGCGAAGACAGGTCCTTAGGATTCGCC
TCCAATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCGCTTTACCACACTGATAGAGAGATTCCACTTAGTACACG
CCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGT
TCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAG
AGAGGGTTATCGATTAGCCGTTGGTAGATCTGGGGTGCGTTCTTCGATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGG
ATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGCTAAGCGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCGC
ATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATG
ATTACCACTGGGAATGCCCACGGGGACGCTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCG
CCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAAT
CAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCC
TCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCG
TCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCGGTCCTTCTGTCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAACCC
AACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGTCACTCTCGATAGGGATCCAGGCACTTTATCCAAT
AGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGAC
TCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCCTTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCG
ATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAG
CGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTAT
CGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCTCTGGATTACGGTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTC
CACCCACTTCAACCGATCTGGCAACTCCCAGGTCTCGCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGT
CGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACACAGTGTCCCATCCGCCAGATCCAACCTTACTCCGGCCGGCACCATGAAATCCATCCCAA
GGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTAC
GGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTC
GGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTAC
CCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCAC
CCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGTCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGA
AAACGCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCT
AGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTCCT