Description :
From Genome Similarity Track
Location :
Scaffold_4:250- 6292
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_4-snap-gene-0.49Ankyrin domain protein
Pytul_var.sporangiiferummaker-pug3_contig_4-fgenesh-gene-0.3240S ribosomal protein S10
Pytul_var.sporangiiferummaker-pug3_contig_4-fgenesh-gene-0.14Mitochondrial Carrier (MC) Family

Sequence
6042 bases(100 bases per row)
TTGCTTTGTGAAAACGGATGCGAATATTTGAAGGCGGTAGAGAAGGTGACAGACCCAACCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTACCCATGCAACGGGTTCTGAAACCCGTTGAAGTCACACTGATGGGCCTGAGCAGACGAGCCAAGCAGCAACGCACCAGTTGGAAGG
AGAAGAGACAACCGCAAAAGAGGGGGACGCTACAGTATCCATTTCGCAGAGCAAAACATGGGTGACCTTTCCAGTTTTAGCGAATCGTAACATATTATTT
CCCATTTAATAGCCAATCCTTTTGTGTGCATTTTGCAGATTCACATGATTTTTGATGTCTTGCGCTGTGGGGTCTTCAATTCAGAGCCGCCCCCATCCGC
CATGCGCATCATTCCATGAGCGAGAGCGTCAACCGCGAGACGAAGGTTCGTGCAACGTGATCAACCGACCGCCTGCGTCTGCGGACCTCGATTGGGCCGT
TCCTTTCTGCGCTTTCCTCGCGCACAACTGCTGACCTCACAGCGTTTTGCACACGCGCAGTCAGTCATCGATGCTCTTCACTCCCACTCGCCGAAGATCT
GTTTGCTCTTGCACGTCTCCATGCGAGCAGATCTCATTTGTAAAGAAAGGTTGGCGCAAATTGATTTCTCTCATTTACGAGCTGCAACTGCCACATGATC
CCTTCTGTCGTGTCAATCTCACATTTCGGTTCAGCATGCGCAGCTACAAATGCCGCTACCTGTGCACACTGCAACTGGGTCAAGACCTGTTGAGGTACAG
CAGTGAGGTTGGATCTGCCTAAGCACGCTCTGAGCCCACTGAGCATCTTCGTCGCTCAAGCATAGCACTTGCGTTTTTTCTTTCGTTCTTGTGTGACTTT
GGCTACCGTTCCACTCTACTCCCGTTCACGTTATTTTGTGCTTGCCACAGTGTACTTCAAGGTCTTCCTGGACACTTGTATCAACTGCAACGATCAACAG
CGCGTGCCCATGCAGTTTTGAGAGTATGCAGCATGACATTTTACTTGCAAATGCATGTCAGGGCGTGAAAAATGAAACATTCCAGCATTACACTTTGCCT
ACATTTCATAATGCAATGCTGTCTCGTGGGCTTCAAACTGATCAGTCAGGTTTTTTCCATGTCGCATTTGACATTTTCTGCACGGTACAACAACTCAGCA
ACAACTTTACGAAATGCACAGTATCATTTTCCAGGATCTGTACAGTACGCTTTTAACCCGTGGGTCTTAACAAGACGGGTAGAGATTTAATGTTCATGGG
TCCAAACCTGTTGCCCGTTTGGGAGTGCCCCCAACCCGTGTTCTCGAAGCTGTTGCCGCCAAATCGCCAAACGACTGGCTGTGGCGGATGGAAAGATGGG
AACCGGTGGCAAAGGAGCTCACTTGCCGTCTTGCGCTCGAAGCGACACAAAGGCACCCGCAGCAAAGCGTCGCTCAGTCATTACTTTGTACTAGTCTAGC
TGCTTTGTTTGTTTGCATGTATTGTAGTAGCCCCAACTGGACTTTTGGAGACCTCCTTTTCACAGTGGTGGTCCCAGGGTCATGCACACTCGCCCCGATT
GCTTCGTGGTTCACACCTTGAGGCGCCTTGTGTGAGGGATAAGCGATGCAAGCAGTTGAATAGCGAAGTCTCGATGTCGAGCATTGGACCGCCTGGGCTC
GCCCTCGCTGGAAATTTGCTCCATTGATTGATGGCTCTATATTCCCAATCTTCTTTGCAAGTCACTTCGACAATAATGCTGGAGACCAACCATAGAGCAG
ATATTTCATTCAATCTCGTGTGAATGTGCATTGCATGTTTTGTTTTGTAATCCATAAGGCATTCAATCTCCCTTCAAGGTAGAGCGTTAGCAATACGAGT
TGTGTGAAAGAAGTAGACGCACTTGATCTCTATCAATACACAACTATTTTTGTGCCTTTCAAATCTTGTGATCTTAATTCCACTTGCCTACTTTGTTGAT
GCTCATTGTGCAAACGCATCGCTATTGTCTATGCATAATGGGGATCTGCGCAAGTCGCGAGATTCGGAAAGCAGACCAGCAGTTTGAGAAGACGAGCACG
TTTGTGCACCATGCGATGGTCGGTGACCTCTCCGGCATGAAACATATGCTTGCAAAGGAGAAAATGGATCCGAACGCGCAAGATGTAAGGCTTCCGCAAG
GGCATGTTGAATAAAGGGAATGCTGTGTACCTTTGTCAAGTCGTTAACAAGTCTACTTTCGACCTTGTTGTGTTGTGCTGCAGCGCTTTGGGATGACAGC
ATTGCATTGGGGTACGCAGGTGCAAGTTGGATGTAGTACTTCTCATCTGCAAATTCACGCGCTGAAATCGTTCTTCCCTCATGTTTATTATATTCAGCGT
GTTACACTGGGAAGCTCGTGTGTGTCCAAGAACTGCTGCAAGCGGGGGCGTCAACCAAAATGGTGGATCAAAATGGTCGGAACGCCCTCCACCACGCGTG
CCGCAAAGACCAGGACGACGTCGTGCGGTTCTTGCTCCAGGATGTGAAAATGGATATCAATTCGACCAGCGAGAACAAGGAAACGCCACTGCACAAAGCT
GGTAAGATGCATAGTGGAATGAATTCAAAACTGCCGTGGAAATTGGCATTATTCTCTTGTATGTCTACCGAAACTCGCAGTGCGTGGTAAAAGTATCAAG
TCCATTGAGCTACTTCTGCAGAGTGGCGCGAACACATTTCTTCGGAATGATGTACGTGCTTTTGTCCTATTCTTTGGCATGGTAGCTCACCTTGGTGTTA
TGTGTTGTGCAATTTAGCAAAACCGCACTCCTCTCGAAGAACTGGACGCGCACCCAGCCACTTTGACTGTATGTGGCAAGAAATGAAAAGCCACAGCTTT
CTCTAGCTCACCCAACGCTCACAACTTGCATCTTTTCCATTATGCTAGGACGTCGTTCCGGGTCAAATCTCTACGGCGCGTGTGAACGAAGAGCTCGAGG
AGTGGCGGCAAAAGTCCCAAACAGAGATCCATTCCAAGCCGAAGGCTCGAACCAGTTTGTCCCAAAACATAGTGATGGGGAAGACATCGAAGCGCCGGAG
CACGGGGCCGATCGAAAACACGTTGATCACCAAGTTTGGTGCATCGATTCGAGAATTTTCGGATCACTGGTCGTCTGACTGTTCGTTCTCGTCGGCGCGG
AGTGGCATGTGGACGCGCGTCGCAGCGACCGATGCAGGGGACAATTCGATGAGCTCCAGCGCTGACAACCTGCCGTCTGTAGTCAACTCGGCTCGTGAAA
ACGATACCTCACCTTCTCCAGTGGCCCCACTTGATCTCGCCGCTGCAAGTGCGTCCCTGAATGCCCCGTCGACACGGGCGTCGTCCATGTCGTCCATTTC
GTCGACGACAGTGTCAGAGCAAGATGGAGGACAGTTTGGGAGTACGAGGCAAAAGAATCTCAGATACGCCGGTAAGCGCGTGATTATGGCGCTGCGAGTG
AAGCAGAAGATGCCAGTCGACGAAAAGCAGGAGATGATTCGGCTGCTGCTGCTGAAATACATGCAGCCAAACAGTACAGCTTGTGGTGATGATGGTATTC
CGGGTAGCGTTTTGGACCAGGACCATGGTTGCACGAAGCCACCAGGCTCCGTAGAGGAAGACTCAGTGACCAAACCCAGGCCGCAATTACACTATTGCAT
CTCGGGACTCACATTGTCGTTGCCACCAGATATCTAAGCTAATCCTACAAATTGAAACAAAAGTTTGTCAGAATGAATCGAGTTTTGTGCTGGTCTGAAT
GCCATTTAACAAAGGCATTGTATGAACTATCCATCCACTGCCGCATCTTCACAACAGAAAATCAAAGTACCTGAGCTATCGATCTCCAAATATCTTTGCA
TCGGAATGAACAAGGCGACAAGTGCTGAAGGCTCCAGAATATACGTCGAGTACTCTGGGAAACGGGTGATCGTCGTGCTTCCAGCCAAGAAACTCTTACC
ACGCGAAGAGGAAAATGAGATGATCCCTTTGCTGCTGCACAAGCTACCGTCGTCAACCGAGGCTCAGGAATACGAGTATTGAAGGTGAACTCTTCTTGAC
CATTTTCAATTTGTCCGAGCTCAATTTGACTTTTACTTTTGCGTAACTATCGCTCTAGTATCGCATGGTAACCATCGATGAAAGGCTATTAGGCAATCAT
ACCAAGCGAAAACACTCTCTACCACGAAGCAACAAGAAGATGAAGAACAACGAACGCCACTCTCTTCTGGTGTAGAAGCCGACCACAAACGCGTAGTTTT
ATTCAATTAGAAATAAAACAGCTCGCTTTAATGTTACAACTTAATTAGAAGCTTCACGACGGTAGCCATCCTGGCCACGGCGGAATTCAGGGTTGAATTC
ACCCGATGGGCCGACGCTCTTGTCCTTGTCGAAGCGACCACGGCCGAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGCGGCCTGCTTCTTCAACGTAGCTGGCACGATCTCGGCAGGCAGGTGCAAGTACGCACGGAGGTACTCGATACCCTCGTTCGTGAGGTAC
CAGTAGTACCATTGCCAGTTGAAGGTCTCCTTGACGTAGCCACGCGACTTCAGGGATTGCATGAGCTTGATCACCTGGAGGTTTGGCACTTCAACGGCCT
CATGCTTTGGCAAGGAGAAATCCTTCTTGCCAACCATGACACCCTCTGCAAACAATAAAAGCAAAAAAAAGGGAAAGAAACGAGTCAGCTCAATGGGTAC
AACGGGTAACGAGTCGTCTGGCAACCTGAAATCAGTCCCTTGCTGCTGATACACAACTCCAATTCGGTATCACTCGAAGCTGTTCATCCATCGTCCACCA
TCGTGTACTGCTGTTGAGGCCATGTTCATTGCATTTTGCTGCGCACTGCTGGAATCACACGTGGCATCGCTGTTGCGCTGCTGGATCTGTATTCCTGGAC
TCTCAACTGCTTCAGGTGGCTTGTGGCACCAGTTGCACAAATAGCGCTGCGATTGTTCCATTGTGCTCTGGATGGGATCACTTTCGCGTGGTCGGAAGGC
AAACAGGTGGATGGATGGATGAACAGCTTTCTCATGAGCCACAAAATGTGGAGATTGCGCCATCACACCGGGACGGACGGATCGCAGAATGCAAACGACA
AGACCAATGTAGACAGGTGCACATAGTACGGACCCTTGAAGAGGTAGGAGTAGACAGCGATGCGGTTCTTCTTCGGGACGAGCATGGTGGTGGTTTTCTA
ATAAAGCTTGCCGGCGAATGCGGATCTTCACTTGGTTTTCGGCCTGGAAAACAGAAATACGTCCCCCATCCAACAACCTGCGCGCCATGGCGGGGGAACC
AATCAATCGGACCCCCCACAAACACTCGGTTTCATACTGTATGCTATCTCAATACAAGCCTCTTTCCTTTTACACAAACCACAATCGCCTTCAATTTGCA
CTGACGTAATTACGCATATTGGTAAAAATAAATGCTTGGGAAAATGTCTGTTAAACCCGATTGTGGTTTTAAGAGAGAGATCAGAGACGGTTCCATGAAC
CGTTGACCGAACCGTGAGTGGCACGAACCGTCATTTTGGACACTTTGGCATGGGGAGATGTTACCATGGCGACACACTACGAAAAAGAAGGGGACGGCGG
CCGTGAAGCGTGCGTGTCGCCTGCGTGCTTATCTGCAGGATCTGACGAAGCACCGCAGCCACCAAGATGATGGAGGAGACGCCTGAGGCCGTCGTCGGTC
ACGAGGACTACTCGGTGCTCGTAGACCTGGCGTCCGGCACGATCGCCGGCATGAGCGGCATCATTGTCGGTCAGCCCTTCGATACGGTGTGTTGAAGAGC
AGTCAAGAGTGTTGCCATTGATGCTGTTTCTGATATGTGATGCTTCTATCCTTTTTTTTTATGTGTGAGAGCAGATCAAAGTGCGGCTGCAGACGCATAG
TACGTTCTACAAAGGATCCATCGATTGTATGCGGCAAACGGT