Description :
From Genome Similarity Track
Location :
Scaffold_1449:250- 3894
Sequence
3644 bases(100 bases per row)
GGAGCACGAGACGTGGAGATGAAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTAAATGGCCCATCCCCTTCGTCAGCTGTGG
TAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGA
CGAGGACCGGGGGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTAATGAGAGATCAAGCATCGGATGCTGAAAAGTGTTTGACATTTGTGGATCTGCTA
GCGGGGCCAGCCAGAAACTGGTATCGACAGCTGAGCAGATCCACCAGGAACAAGTGGTCAGATCTGCTGCGCAGTTTCCAAACACAGTACTGTGGATTGG
GATTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAA
GTTGAAAATCAAGGATGGGGGATCCAAGGTACTGCGGGGACATGTGGATCATTTCATCGAAACGTTGGGAGACGTGGATCTGGCTGACAGGCTGACCCTG
TTACGTCTTCCCGACGCAGATGAGCTTGAAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACATCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATC
GCTAAAAGGCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGGAACTGAATCAGGATCCGTCGGTTCGGACTCCGACCCTGAGGAT
TACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACTACTCTCGACCGGGGGATAACGTACCCGGGGACCGTGGGATGTACA
GATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGA
GAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTC
TACAACCAGATCCGCCAATGGTTTGATCCTGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAA
TCTGGTACGAGCTGAGCGTTCTAGATATTGCATTTATGCATTTGTATACAAGACAGCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACA
CGTGATCTACATGAAGTGTCAGTTGCCAAGGTTTCTAGTTTGCGCGAAGTGGATGAATTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGG
GGGAGCGCGCAGTTACTGGGAGAAACGACAAGATGGTCAATGGTTTGAGCCTATTAAGGGTGAGGTCACTGCAGATCCACCCCAGGTTTGTCAGGTCACT
GGATCCCGCGGATCTGAAGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGAATACTGGAAGTACCATGCCCCAGGAAAATGGCTCAGACAAG
CCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCAACTCCTCGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGG
GTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTAGTGGAGGCATGTACCGTACGAATGGAAGAACGCGGATCAAGATCACGCTGGCAGGT
TGTTTGGTATACTGGTTCGATATTTGGGCTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTAAGGTTGGATC
TGGCGGATGAGACACTGTGTTTCCCGGATGAGATGCGGATCCAGCTCAGCGGACGTCGACCGTTGCACGGGGCGAAGATGAGGATCATAAGGGCGGATAA
GACGACCTGGATTGAGCCCGGAGAAACCTGGGGGCTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGTGAGAAGTGGGTG
CCAACAGTAATCCAAGGACCAGGTCGATCACAATGCCTCCAGGTCACGAACGTCAGCGACAAGAGACTACTACTGGACCATTATGAGGAGGTTGGGCGAT
GGTTGGTGAAGGATGGTATCCCTAGGCGACCTGAATATGTGTCAGTGGGATCCCATCGCTACAGAGAATGGCAGAATCTGGCGTGCGAGGCGACTACCGA
GATCGAATCCCTCGCGGACGTGGAGCTCCCGGCGGAACCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCTCGAAAGATCCTACAGAGGGAT
CGTCAGATTGGTATCCAAGTGGTAGAGATTGGATCCAAAACCGCTGGCGATACCCAGATCCGGTCCTGCGATAGCCCAGGGTTTGTCGAGAATGGCAACA
CCGGCTTACCAGGAACCGTCGTGTGTAAACTCACCAGAAGGTCAAGTCGATCCAAATGGTAGTCTCCCGGTACCAGGATACCCGATCCCATAAAGACAGA
AGGAATGACGGGTGAAGGGGAGTCGCGGTGCTTGGATCCAGTAGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCATGAAGGCGGGGATCTA
CACGCTGAAGATCTCGGAGAAGGTATGGCGGTGATCCCGGAGATACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTAGATCCGGGGGCGA
ACGAACCCGCGGAAGTGGATCGGCTACATCAGAAGATCTGGGAAAGCCGACATCTGCTAATTGGCAAAGGACATGCATTACCACCAGCTACACGTGGAGT
CAAATGCGACATCGATGTCGGTGACGCGAAGCCGATCGCTCAAAGGGTGCGGAATGTGGCGCCTCAGGTCCGAGAAAAACTATAGTATCTGATTAAGGGT
CTGCTGCAAGCCAAAAGCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCGTTAAGAAGAACGGAGTGGATATACGTCTGTGTATTA
ATTACCGACTAGTGAACGGCCTGACCCGACTGATGGTGTATCCAATGCCTCTAATCAATGAGATATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTA
TCTAGATATGGCCAGTGATTTATGGGTGGTGACTACGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTGGACTGTTCGAACGGAGCCGG
ATGCCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAATGCCCTCTACGGAGTTACCCGAATACCGGAACCGGAAAGAGGTGGAC
CAGGGAAAGGTCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACAT
TCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGC
TATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTC