Description :
From Genome Similarity Track
Location :
Scaffold_1483:250- 3685
Transcript NameFunction/comments
Physo_145518reverse transcriptase
Physo_126747reverse transcriptase

Sequence
3435 bases(100 bases per row)
CAGCTCGCGGAGTCGTTTGCGATCTGGATGTGGGAGACGCTAAGCCTGTCACACAGAGGGCACGCTCGGTCGCGCCACACCTTGCGATGAAGGTGTACGA
GTTGCTGAAGGAGTTGTTGGAGACTGGATTGATCGAGACATCTACGTCACCCTGGGCGTCACCGATCGTGATCGTGCTGAAGAAGAACGGGGTCGACATC
CGGATGTGCATTGATTACCGGATCGTGAATGGGTTCATCCAGTTGTCCAACTATCCTCTCCCGCTCATTGACGACCTGCTAATCGGGTTCGAGAGCGCGA
TGTGGTTTATGAGTCTGGACATGGCCAGCGGCTTCTGGGCGATCAGGATGAAGGAGCGAGCCAAGCTCATCTCGGCGTTCGTGTCGACATTCGGTCACTA
CCAGTGGCGACGCATGCCGTTTGGTCTGAAGAATGCTCCCCTGGTGTACCAGCAGATGATCAACAACTGTCTGTGGGGCTTTGTTCGACTACCACCTGGT
AAGGAAGCTCGGGGGATCAGGACGTACTGGATTATCTGGGTTTGAAGCCGCAAGAGGACAACGTCGCAGGGAGCGACGCCGGATCGGATGACGAAATCCT
GTCTGACCGACGTCTACCCGCGCTGACAGACCAGATGACTGTGTTCCAACGTAACATCCCGGCGCCGATGCAGATGGGCCCTGTCCTAGGACGGAGCTCG
TACATTGACGACATCGCGCATGGGGCGCCTACGTGGGATCAACTTTGCATCGATCTGGATGCGCTACTGTTTCGGTTGCGGTATTGGAACATCTCTGTCA
GTCGACCGAAGAGTGAATTCGGTAAGCGCTTGATCCCGTATCTCTCTCATGAGATCAGTGCAGAAGGACTCAGGGCGACGCCGAAGATCGCTAAGGGCGT
ACTGGATCTACCATTCCCGTCTACTCTGAAGGGGGTCCAGTCCTTCCTCGGCAGTCTGAACTACTACCACAAGTTCATAGAGGATTTCCCGGTGGTAGCT
GCAGTCCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCAGGATGTGAGTGAGGGAGTTCA
GGATGCACCAGATGGATCGGCTGCTAAGAAGGTGGTGACACCGGATGTGGGGTCACCAGACGATGTCGGACAGGACCCCGGTTCTGCTCCGTTACCTCAC
TGTGCTCGAGTCATGGCGGTCCTGACCAGATCGAGAACACAGGAGCAGACAGAGTCGAGTGGCCCATTGGGTCCGTTGGAGTTGCAAGCCGAGAGGTGGC
GCAGGATTAAGGCACACCAGGATCAGGATGAGTTCATTTCGGAAGTCAAAGCGTATCTGAGTGGCGACCTGGATCGATTCTCTCCGAGGCGGCTTCGCAA
GATCGCGAAGCTCTCAGAATTGTTTGCACTGGATGCCAGAGGCATCCTGTATCGACTCGCGCGGACTACTCGAGATCGACCTCGGGACGTACAGGATGAG
CCACGTCTTGTGGTGCCACAAACCCTGCACGCTGACTTGCTGCATTACGCTCACGAGGCCTTTCAAGGTGGACACCAGGAAATTACCCGCACCCACGAGC
GGTTACGCTCCGAGTTCTACTGGCCCGGCATGTATGCCGACGTGGGACGTTTCGTGAAGAAGTGCGTTGACTGTGCAAGTGGAAAGGGGCGACCTCCCAA
CCCTGGACCGTCACCTGGTAACATCGAGCCCAGGCGCCCGTTTGAAGTTGTGTCGATGGATTTTGTGACGCACATGCCCAAGTCGGCACGAGGGAACACC
TTCCTACTGCTTTTTCAGGATTCATTCTCTGGTTACGTGATGTGTAAACCCATGTCGTCTACTACGGCACAGGATGTAGCAGAGGCCTATGAAGAGCGAG
TCTTCCGGAATTTCGGTGCGTCGTCGATGATCAGACACGATCAAGACCCACGTTTCATGAGTGAGGTCTTCACTCGGTTTCGGGAGCTACTCGGCAGTCG
TCAGCGCGCCACGTTGGCATATCGTCCTCAAGCGAACGGCCAACAGGAACGTTCGGTGCAGACCGTCATCCGGAGCGTCCGCGCTTACATCGCTGAGTCT
GACCAGTCTGACTGGGACGATCACGCTGAGCGACTGATGTTCGCCCTCAACACCTCGTTCGACGCGACCCGATTGGACACTCCATTCTATCTGGTACACG
GTTGGGATGCGCAAGGCACGGTGTCGGCGATGTTA