Description :
From Genome Similarity Track
Location :
Scaffold_2487:250- 2613
Transcript NameFunction/comments
Phypl_g15128hypothetical protein
Phypl_g15129hypothetical protein PHYSODRAFT_475526

Sequence
2363 bases(100 bases per row)
tGCTCTCCTTggaaacagcagcaccatcgctGTTTTCCGTAGTAGGCGCCAGCACGGCAGAGTTCCCATTGACGTTAGCAGCCGCACTTCCATCAGGAAC
ACGAGCTGCCCAACAGAGCACAACGCATCACAAGATTAGTTCGTAAGAAGCAATCCCATCCTCGCTATGCAATAAATACCCTTTCCCTTCTTTTTCTCGA
TGATGCACGCACTGCGCTGGTCGGATGCTTTGCGTCCTGACCACGCACCCGAAGAAACAATAGATCAGTCACACCTAACTACGTATATCCGGACATCATG
TAATTCATGCGCTACCTTTgacagctcgctgcttgctTCCAGAGGCCTcggtcgtcttcatcttggccatATCTGCGCGTACGTCGTGGAAAGTCGCCAA
CTGCAACTCAAATGGAATTTTGACACGTTTTGACCAATCGCGGGGGCGTCGCCCGAAATTGTGTAAGCAACGTAATTTCAGGCAGTCGCCCCTAAAGCAA
CCGCCCGCGGATGCTCAACTAGTTTATGAATACACTTTAAATCTTACAATATCTACAGCACATCGCATTAAAAATCTGAGGCCTGTGGCACATCGCGACT
TCCGACCAAGCGCTCAAGatggacacgctgctgggTTGGGGAACGCTGGGCCGCGCCAGCCACGACGCCGTTCAGACAAACGACCACgtggacgcagcgc
tggccgtggcgctgctgttcggcttggtgctgctgcctccgctCGTGGGCATCCGCACCATGTACACCAACTGCTGGTTCGTCTTCACCGTGATCGCGCA
CTTGCTGGCGTCTGAAGCGGCGCTGGGTATCGCCACATCCATGGGCATCACCATCATGGTGGGCTGGTACTCGCTGCGCGTGTTCGACCGCTACGCCTTC
ACGGCCATCCTCAACGGCTGGCTCGGGGTCTGGGCCAGCTCGCCGTtgctcggcgtcgcggcTCGAGCCGGTGACatggtgctgcacctgctcgtgccga
tgctgctggtctcgTGCTACCTGCCGCTCGTCCGCGTGTGGATGAGTGTGCCAGCTCTAATGTAGGACAAGTGTGTGTTTGGTTCCTGCTAGCTGAGGTG
TGGAGCTGATTGGTTTGCTGTGCGTTCTGTGTGGTTTGAGCAGATCATCGCGACTGTGGAGTCACTTTGTGGTGGGCGGTGGGGTATTCCCCAAGGCTGA
TCACATTTACCGCTTCtcgccgccacgctcgcAGCATTTTTGGAACGCAGCGTACAAGATGGAGCTCATGCTGAACCTGCTCGTCCCGCTCTTCTGCGTC
CTGGCGCACCAGGTAGTAAACTGAAACGTAATACTCGCGCGGTCTGCTCAGTCAACTAGGCACCATTGTTTTGCCTGGTGCTGGGTGAACGCGCTTAAAG
TCCTTTCTAATATCATGTTTGTCCTCGCTGGGTGTTGTTTGGTGTCGATGGTGTGTGACAGAGATCATTCTGGGTGTATGCCGCGACGGCGATCGCGGGA
GCAATTCTGTTTTGCCTTCAGCTGATCCGCTCGTTGTTACTACCCAAATTGCGGAGGAATGCAAAGACCATTATGTGTCGCCTGCTATCCAGCGGCGGCA
TCCGACCGAACTTGGTACGTCCCTTGCTCTGGCTTCTCTTGTCGTCTCGAACACGCGCGCATCGACTGACAACGTCTCATATCTattgcttgctgctgcc
tcccaGGATTTCATCGTCCGAGACGACTCCTTCTGGCTGGACTGGATGAGCGAAGGGCTCGTTGCGATTGGCGAGTCGTATGTTGGTTGTCTGTGGGCAA
CAAATCCCGCTCGGACTCTAGACGAGGTGGTTGCTAGTCTGCTTACCATTCCGATGGAGGGCAGACAGGAAATGTACCGATCCTGGAGCGCCCGCTTtgt
ggcgctggctgcgcgaTTGTTCAGCTACCCACCGTCGTCCATGGGGCTCGTTGTGGGCGCCGTCTCGGAGCAGTTTGATCTCTGCCCCGAGTTTCGACAG
GCGTATATGGACCGATATTTCCACCAGGGCTTTGGCATTTGGACTGCAGGGACAACAACCATCGACGTTGCACAAACCAACAAGCTTGCTAACTTGGACC
AGCAGCTGGATATTCGGGTAGGTGCACGATCAAATAGCGTTGGCTCCTTCGTCGCTGATTTCGGAGCTTCCAACCTGtatttttttcttctctTTTGTCT
TGTATCATTCAGCCCGGTCACACCGTCTTGGACATCAGCATCGGTTCGTGGGGAGGGGTCGGCTGCTACCTCACTCAACAGCACCCCGATGCCACGGTTG
TATGCGTATTGTCGTCGGTCCAAGAGTTTGCACGCGCCAAGAAATTCGCACGCGAACTTGAGG