Description :
From Genome Similarity Track
Location :
Scaffold_842:25- 4046
Sequence
4021 bases(100 bases per row)
CGCATCAAGTACGTGACTGTCCGTATCTTGGCAAGCGTCCACATGAAGATGAAAAAAAGGAAGGCGCACACAAGAAAAGTAAGACGAGAAGTGGAGGAAA
GGAGACAGTTAAGCGCGTTTACAATGAAAGTGATGAGGAGGCGTATGTCATTCTTCAGGCGTTAAAGATGAACAAAGGGGTAGCAAAAGTGGCTCACGAT
CGTTGGTACATTGATTCTGGAACAACTAGTCATTTTTCAAATCAAATGACCGATTTTGTGGAGTTTACCCCATTCAATGCACGTGTGAGAGTTGCTGGGA
AACACTATTTGAGTGTTGAAGGAATTGGAACTATTAAAAAGGAGTTGCAAACATCCCGAGGTCGCTGTGCAGTGACGTTATGTGGTGTTCGGTATGTTCC
TGAGTTGCAATGCAACCTTTATTCGGTGAATCGACAGTTGAAAAGTGATGTGGATATTAGTGAGCGTATTAAAGTCCATTTTGATCGACAAGATGTTGCA
GATGTAATTCTTCGTTATGGTACGACTACAGCAGAGTTAGATGAAACGAATTTGTGTCACCTAAAGCTGGAGTCACCCCAGTATTTAGCAATGGCAATTA
CTTCAGGTGCAATTCAAGAACATAAGTTGGAGCTGTGGCATGCCAGATTAGGACATCCAGGAAAGACTGTTCTCAATTCGCTGTTCAGTCACGATCAGTG
GCCCCTATCGAATTTGAAACTGCGTGTTCCAGAGCCTTTTACCTGTCAGACGTGTGTAAAAGGTAAATTGGCCAGACACCATTTTCCACGCTTGAATTTG
CAGTCACGCGAATGGCTGGTCGGTGAAATGGCTCATGTAGATATCTGGGACCATATTCAGTGGAAACTTACGGTGGAAAACGATACTTTGTTGTTTTTGT
GGATGATGCAAGTCGTTTTGGGACTTTGTATCTACTTACGCAACGCTCAGACGTATATGCGAAGTTTGAGCAGTACTATGAATGGTGAAAACCCAGCATC
ACGTCAGAATGAAGGCATTAAGGACAGATAATGCGAAGGAGTTTAGGTGTTTAAAGCGACGATGTGAGTCAAAATATGGAATGGAGTGCACAACAACTGT
TAAACACACTCCTGAGCAAAATGGCGTTGCAGAGAAGATGAATCGCACGCTTACGGAGAAAATGAGGTGCATTCTTGCTCACTTTAAACTGCCGCAAGCT
CTGTGGGGTGAAGCAGCGATGACTGCAGCGTATTATGTGAATATTATGCCAAGTACAGTTCGTGGAATGGAAGTTCCATATGCAGTATGGCATCGTCGAT
CCCCGGAGTATGCTCGGTTGAGAACGTTTGGATGTGCAGTCCTGGCATATGTGGATAAAGTGGAAAGGCGTAAATTGGACGCAAAGGCTCGAGAGGCTGT
ATTTGTTGGGTATTCCCGTGAGAAGAGGGGATATCGCTTGTTGGATAGCAGTACCAACAAATCTTTCTACAGCCACACTGTTGTATTTTATGAAGATAAA
CATGGTCGGCTTCTTAGCAATGCATCAGAGCAGAGTGCTTCTGATCAACGTGTTGTGTCAACCAATGAGTATTTTGGTATCGATAGCAATGTCGAACCCA
TGCTCGAAGACATGCACGAAGCTGAAAGCGATAATGGTGACGGTAAAGAAGGTGGTCATCGGTCAGGTGGGGCTGATGACATCGTAAGTGATGACCGTCC
AGGTGGGGCAGATACAGAGTGTGATGCACGGTCAGGTGGGGCCAAAAGTGGTCACGCTGACAAACTAGATTGTGCAAGTGGCACATCCGAGACTGATAGT
CAATCTAGTGAGTGCAATAAATGCACTAAGAAAAGAGGTCGGACCAAGAGTGGCGCCTCCGAGACTGTTGAGTCTCAACGTAAGAGGAGCAAAACGCGGT
GCGAGGCACCGGCATCAGAACCATCAAAGGCTCCATGCACAGAGGCAATTTCCACTTCAGTGTCTCGTGAGATGACGACCACGAGCACGAAGATGCCAGC
AGAATCTCGTGGGCTCTCAAGCAAGGGGGGCGTGACAACTTCCTCATGTAGAGGGCTGCGAGAGTATGTGGCTCCGAAAGGTGCAAGTGCAGAAGGTTAC
ATAACCCGGAGTGGACGGGTGAGTAAACCACCGCCGTGGTTAAGTGACCACATTCATATTGGTTATTCAAATGCGATTGAGAATGAAAGCACATCTGTGT
GTTCTTCTTCTGTTGAATGGGTGAGAGCTCGTGAGGAGCTTCAGCACGCAATGGCAAAAGAAAATGCCAATTCATGGTGGCAAGACTATTGCTGCATGAC
AGAGAGTGCTGTAACTGAGCCAGAAACATACAAAGAAGCAATGGAGTGCGAGCAAAATATGCAGTGGAAGCGTGCAACAAATGCCGAATATGAAGCGTTA
CTTAAGAATGGCACGTGGAAATTGTTACCACGCAGGAAACACATGAAGGTGTTGAAGAACCGTTGGGTGTTTCGAATTAAATATTTGCCGAATGGTGAGA
TTGATCGATACAAAGCGAGGCTTGTAATTAAAGGCTTTATGCAAGTCTATGGTATTGACTTCCTGGAGGTATACTCACCTGTGGTCAGGCTTGAAACGCT
GCGTGTCCTATTAACGTTTGCCGCAGTCTGGGATTACGAAATACACCAAATGGATGTTACCACTGCGTTTCTAAATGGCAAAATTGATGTTGAAGTATAT
ATGGAGCAGCCAGAAGGATACAAGAAAAAAGGAAAAGAAGATTGGGTGTGTCGCTTGTTGAAAAGTCTGTATGGCTTAAAACAAGCACCACGAGTGTGGT
TTCAACTTTTGAAGTCTTTCTTGGAAGAGCAGGGGTTTACTATGTTGAAATGTGAACCTTGTGTGGCTGTAAAAGTAATTGACGGGCAGCTGGTCTTTAT
TCCACTGTATGTGGATGATTTGATCTTGTTTGGCCCCAGCATGAATCTCATCAACAAAATGAAGCAAATGTTACGAGAACGTTTTGAGATGAAGGATCTT
GGAGAGCTGCATTACATTCTAGGCTGGGAGATCACACGAAATCGAGAAGAGAGAACAATATTCATAAATCAGCACAAGTACGGGAAGTCAGTGCTAGAAC
GTTTTGGTATGAGTGGATGCAATGGCTGTAAAACACCAAGTACGCCAGATTTGAAGTTGACGAAAAGTATGTGTGCATCAAGTGCCGATGAGAAAAATCT
GATGAGCTCGAAGCCATATCGCTCTGCTGTTGGTAGCATGATGTATTTAATGCTTGGTACGCGTCCAGACTTGGCCTATTTAGTGCGTGAGTGCAGTCAA
TATTTGGAAAATCCTGGACTGTTGCACTGGCAAGCAATAAAGAGAGGCTTACGATACCTGAAAGATACAGTGGATTGGGGCATTTGTCTTGGTGGACGCG
AGTGGATAGGCCAAAAGCTAGATCGACATCTAGATGCTTTTGCTGATGCAGATTTTGCGAATCGAGTTGACGATCGGAAATCTGTGGCTAGATATATAAC
CAAGTTCTGTGACAGTACTGTTTCTTGGAGTAGCCAAACTGAGAAGACAGTCGCATTACACACTACAGAAGCAGAGTATATGGCTTTAAGCCTGCTGGTA
CAAGAAGTAATTCACTTGCGCCAAATGTTCAAGGAGTTGAAGGTGGAGCAGAAAGCACCAACACAAGTATTTGTGGACAATGAGCGCTAAGAAGTTGGCC
AAAAATCCTGAGTTTCACAATCGTACAAAACATATTGATGTACGACACCATTTTGTGCGAGAGCGTGTGAAGCTGCAACAAATTGATGTGTTGAGAGTTC
CTGGAGATGTGTATTGCCGATGCTTTCACTAAGCCGTTGACCAGAGTTAAATTTGAAACGCATCGTGCGGCAATGGGGCTGATGTCGGAGAAGGAGTATA
ACAGAGAAAGCGTATAACAACACAAAGCACGATATGGATATCAATAGGTGGGGCTGTGGTGAAGTTGAGTGTATTGATCCCCACGGTTAGCTTTGTGTGT
ATGTTGTGTATGACAGTTAGT