Description :
From Genome Similarity Track
Location :
Scaffold_467:25- 3452
Sequence
3427 bases(100 bases per row)
CTTATGCAAAAAGGCTAGCTCGACCCAGTTTCCAGTCGCTAGTTACTACTACGAAACGAATCCACGAAGACTGAAACTGGGGGCGTGGCGTCAAAGAGTG
ATAGGGATCAGGTAGTCTTGGGCTGAATATTGAAGAACTTGCCCACTAGACGCTGGATCTGGTGTCCTGGGTGTTGGCTCGGGTCCCCACGAAACTGGAT
GCGCCAAGGCTCGGCTTCGTCGATCTCTCGCAAGGCTTCAGTAGGTTCGTGTGTTCTGGGCGACGGAGGTTGGGATTCTCCAAGTTGGGCTTGAACGGGA
TACGGATCTCGGAAACCAAGCTACCTTATCCCCGCGTCGGGGAAGATGCAAGAAGGATGGATCCAACAAAACATCCACGTCACACCAACCGTCCTGGATC
GCCAACACGAGGCTCACGAGGACTTTCTTCCAAGCTCGACCAGCATGGCTACGTCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAAGTCGAACCCT
GCAGTTGATTACGAGAGATGGGGAATCGGTGAGTGCCTTCCCATATGCAAACCCGGTGCTTGGTAACGAAATCCCGGAACGAACGACCCGAGACGCCCGC
GCACGTCACTTCGGAAGCTTACCGGATCCACCGGTGTGGTGACCAGCGTATCCCACGGGGCAGCATTTATCAATTCTTCCACGTGAGGCTGAGTGATGAG
CGAATCCACGTATCCGGCCGTCGGGATGACATCCGCTTCCCGAGGAAATATCCATTCCGCTCGAAAAGGCAACTCAGGGAACAGGACCGTGATCTTCATT
GAGATGACCGCGACCCGGTTCAACTTCTTGGCGGATCAAGGCTCGATGTCTCTGGTAGCGAAGGCCACAGGAGCACGCCTACCAGGAATGAAGGCGGCAT
CCGGACCGAACGGAGCCACGGGGAGCATCCCTGGCAATGACGAGTTAGGGGGAGCGGGGATCAAGACAGATCCAGGGGATCCGCCACCATGAGGCGATCC
TGGGGAACCGCCACCATGAGGCGATCTTGGAGATCCGCCACCATGAGGTGACCGCCCTCCACCAGTTCCGGGGGATCTGCCACCACGAGGCGACCCCCTC
CCACCATCGCTACCCGATCTACCATCACTGTCGACTTGAATCGCGGACCGCCTCCGGATCCGGCGGTGCCAGCGACTTGCGGAGGCGGTGTCGAGAGGGA
TCTCCGCCGGGCTTCGGATCGGGACTGGGACAGAGCCCGTCGCGTGTCTTCCTCCAAGGCATCCTCAGCGGCTCGAGCCTCCTCCGAATCCTCCGGACTC
TCATCGTCGTCGTCGTTGTCATCGTCCTCGTCGCCCAGAGTGAAGGGATACGGGCCGGAGGACGACATACGCTTCGACGACGATCGGATAGGAGGCCCTG
AGCCGTCGGACCAGTCCGACTCCTCATCCTCGTCGTCCTCCGAGCTGCCAAGTCCACATCCCGGGGGAATGGCACGTTTAGCTTTCCCCTTCCCAAACCC
GGCACGGGCGGGCGGATGGCCGGTGGAAGCTGGCTGGGGAGCGGCAGGCGTCGTCACCGAAGGGGCAGCGGTGGATCCCGACTGAGACTGTCCGGATTTA
GCCGTGGATGGAGCTAACCCCGTCGTAGGAGCAGCGATGACTGAGGATCCAGTTGACACCACTGCCTGGGACGACGGCGCAGTCGTGGATCCAGTTTTGG
GCGCCGATCCCGACTTGGATACAGCAACGGATCCGGCCTTGGCAGCTGATCCGGATTTGGATGCCAAGGATCCCGCTTTGGATGCCACAACGGATCCAGT
CTTGGGTCCGGATCCGGTCTTGGACGCCGTAGATCCAGTCTTGGGCCCAGATCCAGTCGTGGATACTGAAGTCGACTTGGATGCAGTGGTAGATCCGGTC
TTGGATCCGGCTCCAGACTTCGAGGAAGAGGCGGAAGTTTTGGACGTGGATGTGGGACCCGTCTTGGATGTGGATTTGGATCCTGCCTTGGGAGCGGATG
TGGGTCCCACCTGAGAGGCCGCCTTAGAGGCCGAACCGGTTTTGGATTTGGCCTTTGGGGAAGCGCGAGCATGCTTATGAGGACGGGGGGATCCGGTGCT
AGGAGCGGGAGACTCACTACGCGGACGTTTCGCAACTGACAGATCCGCCCCACTTACAGACGGGAGAGGAGCAGAGACGCTGGCAGCACGAGAGGGTCCC
GAAAAGGGAGGAAGGGGATCCGACACGGCAGCTGTCACCAGCGCCAGTCGTCGACGAGCCAAATCTTGTTCCGATAAGCCACGATCGCGCTCCAGGACCA
GCTGTTGCTGCTGAGTTTGGGCTGCAGCGAGTTGATCCCGGAGTTTCGCGGCGGTCGCATCGGCTTCTTTCAATTTGTCACCTGGATTGACAATAACGAG
TGAATATGGGGTTACTAGCAAGGACTAAAAGAGGATCCACGTACTCGTGCGGTGAAGCTTGGATTCCAGCTCTGCTGGCGCACGCTTGCATCCGCCCACT
CGGTCGCCCGCCTGTGTCCCGCTGGGAGTTTCGCTGTCCGCCAGCTTCGCTTGAATCTGCGTCGCGACAACTGAGATTATACGCACGAAACTCTTCGAAC
GCGTAATCTCGTCCGGCAGACGCTTTCTCGAAGCGATTTCTTGGGTGTCTTGCAACTCCTCAGAGAGTTGAGCCAGGGCTACATCTGGCGAATAGGGAGG
TGGATCTGGCGCGGGGGGCCCTCCACGCGCCGGCCCTAAAGCGGATCCGCCATGGGTGGATCCCACATAGTCGTTGGTCACCACCTCCTCTTGGGTCAGA
CGCAACTCGTCACGGAGTCGATCCAAGCTCGCATCCGCGGCTGCCCCAGCAGTCTGAGAATCCTCCAGATCCCGCTCGAGGTCGTGGATCCGAGATTGGA
GCTGGTGGATCTCAGATCCGGCGAGCGCCATCTCCCTAAGGAGATGGTCGTTGTCATCTCGCATGACATCTCGCTGACGGGAGGCGCGATCCAGCCGTCC
GGTCAGGTCGCGGATCTCGACCGCCTGATCAGCCAACAAGAGTCGCAGGTCCTGCGACCGAGAGGCCGCACGGTGCTCCTACCCCTGGATCTCCATAGCC
TGGTCATGGACTTGGGCTCGCAAGGTCTGAAGTTGGGTAGTGTGCAGAGACGCAGCTTTGTGGTATAGTGATTTCTCAGTAGTTGCGGATTATCACCCGT
CGACAAAGACGTGACACCGCCCAAGATGTTCAAGCAACGAACCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTC
CGAGTTTTCAACAAGTATCGGATACGGCCCTATGTCACTGAATCCAGGCTGTCCTTATTATTAACAATGGACTGGCCGGATTCGCATTCAGCGGACCATC
TACGGTACGAACCCTCAGTGGCGGTTG