Description :
From Genome Similarity Track
Location :
Scaffold_2820:25- 2762
Sequence
2737 bases(100 bases per row)
ACGTGGGACGCGGTGCCCAGAGGGGGCAAGAGATACTGACCGTCAGAGAGAAATGACGGCTGGAGTCGTTTTTTGGCCGACCCCAAAGCTGGAGAGATTG
GGTGAGATGGGTGTTCATGAGAACCTGAGATCACTCGAGAGGAGCTGAACTCCTCCTCGGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCG
TCAGACGCGCTTGGGTTCTGAGATCTTTAAGAACCCCAAGGAGCCAGTGTATCCTTTGGTGACGGAGTATGCGGACGTCGTGAACAAACACCCACCGACC
CAACTCCCACCGGATCGAGTCGTACGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGGTGCCTTCTTCGCC
GCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCTGCCTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGCTCACG
CTTATAACAAGTTGAACAGCGCAACGGTGCCAACCCAAACTCTAATCCCACGAAAGGATGTGTTGTTAAACAGCATGACCGGGAGCGTACTGTACAGTGC
GCTGGATTTGGTAGACAGATACTACCAGATCCTAATGCGGGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTC
GTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCACCTGGTGACGCAGCTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACA
ACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGCCGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCT
CTACGCCAACATTGACAAGTGTGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTTGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAGGGTC
AAGGCCCATAGCAGCATGGCCGACTCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACACGTACAGCGCTGGGTACGCG
GGCTTCGCTAAGCCCTTGTCGAGCTTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCC
AAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCCCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGA
CACGGCTGAACAGGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGGACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAA
TATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTTGCCTCACC
TCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCAGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTC
TCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGAGCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGACT
ATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTTCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCC
TCTACTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGAATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTC
CAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGT
AAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCA
TCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGT
GACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCT
GCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAG
TGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGC
GTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCTCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGA
GAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGGTCAGTTTTCGCTGCGGAAACCGGTGGAATCCCTTTATGGATAACAAAGCTGAATATT
TGTCAGCAGGGTCCCGCGATGCCCATGGCAGCTGGCC