Description :
From Genome Similarity Track
Location :
Scaffold_774:25- 2200
Sequence
2175 bases(100 bases per row)
CTTTCTACGCTGACGCCTCTCTCATAAGGAAAGATATAGTTCTTATCTTACAATGCTGGTGCCCCTACTTACCGCGGATACCCCATTGATAAAAAAGATA
GGGGAGCAAGCTCTGGAACTCGCCCTTTGATAAAAGTAATTCAGTTCGAAGAACTGAATCAAGTTGCAAAATACTATACAACAGCAGACACTGAAGAATG
AGTATGATGTAGTAATTCAGTACAGTATGATAGGGCAACACGATCGGCCATTGCTTATGATCGTTCAGCATTTGCTTATGTGGTCATATTCATCTTTGAT
GGATTTTAAGCCAATTACATGCGTGCGTCACAATAGTGACCTAGCCAAAGAGTGACATCTATCATGCTAATCGACCTATAAGTGGGGACGGGCTAGATCG
TACTTAGAACGTGTTAGGAAGGATCAGTAATGGAGTTAGCTTACCTAACCGCGTTATTTACAGACACACACATACACAGAGACAGATAAGTACGATTTAA
AAGTTCGGCATTCAACCTTGCGAACACTCACTAATAGCTTCACCCTTCGGGCTCGCAATAATCATTATCTTACGATGCCGGTGCCTCTACTAACAGTGCG
GTAACTACATGGATAAAATTATGATCTATATCATACAATGCCGGTGCCCTTAGTAAACAGCGCGTACACCCTGGGATAAAGATATGATCTATATCTTACA
ATGCTGGTGCCCCCTGAAATTTATCAAAAATAAGGGAGTCATTTAGAGTGCAATACAGAATTTTAGACCCCCCTCCGCTGCTCACCTCACCACACCTCAG
TTCTTTGTATAAAAAGTTATTGTAATCTCGCCTTTCTAGTTAGCCTTATTCCTGAATTCTTGTTTCATTTGCATCCCAGAAACACACACGGCTTAAGGTA
CATGGCCTTTAAATTAATATGTAAGAGCAAAAATGGCTGGTTATGGAGTTCTTATAAGGTAACGATTTGCGCCCTAAACTTCTTACCGGATTTAGAAATT
ACTGACTCTGCATTCTTTTAATTTGGTCCACGTGCAAATATCTCGATCCATACTGAGCTGATGCTTGAGCCATTTTATATGTAGCGGAGCTACACAGCTC
TTAGTCAAAGGAAGACTTACGGACCTAGAAGTCACTTAGTTCTAGGGAGCTAAGTTCCGAATAATTTAAAGAGTCTAGATCTCTTAGAACTAGTCAACAA
AGACTCTGAGAGTCTTTAGGATCGTAAAGCTTCTAGTCCTGGTTCAAGGGACTAACGACGACTCTAAGAATCGTACGCACAAGGTGCCCTAGAGTATACG
CCACAAGCTGACTCTTACTCTTAACGATCTACTGACGTCTTTATAAGACATGTGTCACTCTAAGATCGAAAGGGGAACTGAAATTTTATTTCTTAGTTTT
ATCTGTAATAACCTCATTCAACTACCTAATACTAAGGTTAAACTAGTTCGCATAGTAATCGTTAGTATATTAAAGATTGATGGATGTTTCATCAATCTGT
CATCAATGGATGACGGAGGTTAAAACCTACATCAATTATGACAGATAAAACTTAGGATTGTATATAGCATATACAAGGTATGTGCCTTTCGAGCGGTGAC
GGTCGTGTGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN