Description :
From Genome Similarity Track
Location :
Scaffold_266:25- 1789
Sequence
1764 bases(100 bases per row)
CCAGTTTGTGCGGAAGCGCCAGAGAGTCCAGACATGGACACTGATGCACAAGTGTGCGGCTCTAGAGCATCCGAGCTAGCCCCCGCAAGTGACAGCGACA
GTACAGGTGTACGTACATGTGTCAACCAGTTCATGCCACCCTAATGGTGCAGTACTGGAGCTCAGAACCGCGAGGTCGCGTGTTCGCATCAACCGACGAG
GACGACGCAAGTTGTCAGCTCGCAAGAGAGACAGTGCATTGGCATCTGTTGCTGAGGAAACGGCCACCTCGCATATGATTGTCCCATCTCTCAACGCAGC
TATAGCTTCGCTGCGCGCCTTTGATAGGATCTCGAATCCGTCGATAGATCGCGCTCACATTGACGTGGCACTCGGACGCGCAACGCGTAGCCCAGAAGCA
AACGCATCAGACGAAGTGTTCTTCGCTGAATTTGCGGCGCCCCATAAGCTGCCGAGTACCGTTGAGGCGATTGTATCCCTCGAAGAAATGAGCTATGAGC
TCTTTCTTGCAGATTTAGAGCGTGATCAGATCCGCGAGATCGTCGTTCCTACCGCGTTTACGCGTAGCGAACTATGCACCTCGCCCACTGCGGGTGAGAA
TGTTTTTGGAGTCAGATAAACAGAAACGGTTTGCTGCTCAGGATTGGGACGCCGTGAAAGGCAGTCCATACTTTGACTTGCTGTGGGAGTTCAAAGATGT
TTTCCCCGACAAAGTGCCAAGTACCCTGCCCGTTGACCGTGACGTAAGGCACGAGATTGATCTCGAGCCCGGGAGCAAATATTGCGTGACCAGACAATGG
CCGCTGCCCCGCGAGCAGGTCGAGGCTATCGACGAGTTCTTCGCAAAACGAGCCCTCGCCGGTCATGTGAGAGAAAGCAAGTCTCCACGTAGCTCATCTA
CGTTTTTGTATGCGGAAAGCGGCTGGTGTCTGGCGCATTGTTCACGCTTTCAACAAGCTGAACGCCGCCGCCATTCCGGCACAAACGCCGATCCCAAGAA
AGGATATCTTGATCGACTCCATGGGCGGCTCGACAGTGTTCTCAGCACTGGATCTGATGGATGGGTCTATCATATCTCATGCGAGAGAATGACATCCTGA
CGGCAATAAGTACACCCAGCGGAATGCTGTGGGAGTGGCTCGTGACGCCGCAAGGTTTGAAGAATGCACCAGCGACGTTCAATCGTCTGGTAACGCATCT
TCTGCGTCCTCATCGTACGTATGCACCGAGCTATTTCGATGGCATCTTTGTGCACAGTTGTGCCGAAGGAGATCTTAGTGTCGTTGACGTGCACAAGAGA
CATTTGCGCTCATTGTTGCAGTGCTTACGAGACAACAGTCTGTATTACAACCTGAAGAAGTGCATCTTTGGTGCCTCAGAGATTCCGATCCTGGGCTGCT
ATGTTGGCAAAGCTGAAGTCCGTGCGGACCCAGAGAAGATCAAGGCGATCGCCGACTGGCCGATCCCAAAGTATGTCAAGAACTTGCGCAAGTGGCTTGG
CTTGGCAAACTATTTGCACAAGTATAGCCACAACTATGCGACAAGAGTCCGTCCACTCACACATCTCTTGAAAAAGGATGTCGAATGGGACTGGACAAAC
GATGTCATGAATGCATTCATTGACGTGAAGGAGTCGCTTGTTCGCGCTCCTGTCCTGGTGTTGTCGGACCACACGAAAGCTTTCAGTGTCGTGTGTGACG
CCAGCGATTTTGCAATCGGCCGTGCGCTGATGCAGAAGGATGATGACGGCCATGAGCGCGTCAT