Description :
From Genome Similarity Track
Location :
Scaffold_287:25- 1757
Transcript NameFunction/comments
Physo_125579hypothetical protein

Sequence
1732 bases(100 bases per row)
AAAGAGTGTGCCCGTTTTCCGACTTGATTTGAATGCGGTAGCCATCAATACCTACCACCGAATACACAGCCTTAGACCATCTTGCTGTTTCTTTATCAAA
TGTTTTCTTTTTTAGTCGATACAAAACCTTTTCACCGACCTCGAACTCGTTTTCAATCCTCTCGGCTTCAGCCTGGTTGTGGACTAGTTCAGATTCAATT
ACCTTACCTTTAGCTTCGTTGGGGGTCATACCAATCGTCCGATGGGTCGTGCTGTTGTAGTTCTCAATAACAGCAGCTATGAGCTTCTGGGTTAGTCACT
TTGGTTCGATTTTGACAAGGCGCTGCTTCAGAGTTCTATTGAAGCGTTCAATTTTACCCATTTCGGCGTGATCTCCAGGCTCATTGTTGAAATGATCAAT
TTTCTTAGTTTTGAATAATTTCTGAGCCTGTTGGTTCATGAATTCTGAACCATTATCGGTTGTGAGAATGTCAACCTTATGGAGGCGGACAAAAACCCTT
ATTGCTGCTAGTACGGTCGGGCCAGTTTTGTTGGTTAGTAGTTTTGCGTAGCCTAGCCGAGAGTTGACGTTGATCGCAGTCAAGATTGGTCTTTTCTCCC
AAAACGCCAAGTCCATCTGCCACGAATTGGGGTTAGTCGATGCGACTTTGAACCTATCGTATCGCTTCTTCTGCTCCTGAAATCGCTGAATATCGCTCTG
GTTTGAGTACCATTCCGTGACGATTTTCATCGTAATCTTCGGCTCCAGTTCTTTAGCCTTCTGGTATAAGGCTTGGGCACCCACATAGCCCGTTTTGGGG
TCATAGTATAATATGGACAACAGCTGATCCATCGCTCTATATGGTTATAAAACAAAAAAATCCCCTGCCAGGTAGTTGCTTATATGTCGAGCGGTTCGGT
GGTGATACCATCCGCAAGTACACGACGCTTGTCATAATAGTAGTTTAGAGCTGTTTTAGTCTGGGTGTACGTAATGATTGACTTACTCTCTTTACTGAGT
CTAAACCCCTTGTTGGTGCCCTGTAGCGTGATGCGATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN