Description :
From Genome Similarity Track
Location :
Scaffold_29:25- 1734
Transcript NameFunction/comments
Phyca_LT153473374gag protein

Sequence
1709 bases(100 bases per row)
agagcctccacatacggtttaaaaccgtcaacagtggagcgccggacatagttgccggacgctcccgagtctatcaagactcgccacggcttgtcgaagc
ccttcacgttcgcttgaacgactaacaagccgggcttgcactcactacgtgagtaagagagcttagctctctgcggggctgagtcccgttctctcctgcc
tcccagaggcccaacagaactcagttcctccccagtagggcgccccgcgcctactgggttccgtcgtttccccgcgacgaccctggttgagggttcgaag
cggtgcttcggctcgattgagcctgggccttgttgcgcaacgggcaactaggcctcaagtggcgggtgcttccgcacgtgtagcatcgacggatgctgta
gcgctgctcagcagcatagaggtcagcctcgtcttcagcgtggctgaggtccatcggttcaggaccgctcgaagagctcgcgctaccagcgctcgaacca
tgtctcgcagcctggaagttatagtcggcattcaatgccacgttcacggcctcctcgaatgaggcagggtgaacacggaaaacttccgttcgggcagcgc
ccgtgcgcaggccctccataaacacggtcaccgcgaccgcctcggggagagggctcgacgccataccggcgatcagagttctcaactcttggacatagtc
cagcaactcctttttaccctggcgggtagcaaggaacttcgaccgtgtacggtacgcctggttaggcggcgcgaatacgcgcattagttgctgtttcagc
tgatcccaagtcgggaaagcagcgtccacagacgtgccgcacgttagtgcccattcttgagctcggccaccgagcttcgagatcgccagcgctacgcgct
gttgctcagtctggagcagggccgatcccatggccatctcgacctgtcgggtccagagaaggagattctccccttccttcccctcgaaggtcttcacgct
caccatgagcggtttcggtctattagaccactcgtgcgtcgacgacgcggccgcggacgatgcggcggacgccgttgcgctcacgcgctcttgtacatgc
tctaagcgccttctcgtagcttgcaaaaacctccagtctggcggacaccgcctctggtccttgcgaagcaagatgagcaatgccctcggggcccaacaga
gacataagctttttaagcgtctcttgcaagcctggcggcaagctcgcgaacacagcgtgttccatcctctcagagggatcagtcaaaagactcagtcgca
ggattgactacaagtgctaccaagtgtagcggggctgccgtagcttagcgtcagaggaagacggttaactcaacgagttaaggattaacacacaccttat
taagggttaataggccttaatatccgaaggcacctactaactacgaccttaataaaaggactttactcttagtgttcccaatccaaaactgtttatttat
cttttattgcggctagccgcctagggagtaaatgtatgtgtttaactatctaacatagtaaaaccaagtaaaatcctacttcaaatgcataacgtgtagc
tctcagccacacacactcccttgagtgtccgtacatcaaatatgtaccttacacaaagtatatccatgtgtggaacacaccaggtgtaaacccgtgtaac
cccgttaca