Description :
From Genome Similarity Track
Location :
Scaffold_2891:25- 1697
Sequence
1672 bases(100 bases per row)
GAACCCTTGTTTGGATGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTC
TCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACG
TCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATG
GTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCA
TTCGCAAAGAGCATGACGTGATCTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTG
CCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGCAGTAATT
AACCGCTCCAAGAAACGACTGCATGCTCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGTCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGC
GAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAGATGCTCTTGGTGAAGCTAATGCTGATCCGGACACTGTGCAAATCTTGCCAGCATCGGTC
CAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGAT
TCCCCGTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAA
CGAACCCTCGGCGCTTGGTCCACGACGTTCTTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAATCAACCTCCTTTAGTTGAACGAACCC
CCAGAGTGCGTGGTCATACTTACGCGGGTAGATACTCGGCGCTTTCTTTAACCCCAAGAGGCCGGGTAAACCCTCCAAAATTTTCTAGTGGCCCGAGGAA
GCGCGGACCCCTTTAGGCGCTCGCAAGGTCATCATGACCCGCCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGT
TAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGAAAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTT
TTTATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAA
ATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACC
ACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTC