Description :
From Genome Similarity Track
Location :
Scaffold_4021:25- 1615
Sequence
1590 bases(100 bases per row)
AACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACTCAAAT
GTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATC
CGACTCCCATACACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGT
TGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAAC
ATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGGTCTGCAGTGACCTCAGCCTTGGTAGGCTCAAACCATCGACCTTGTCGGCGCTTC
TCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAG
CTGGCACTTCATGTAGATCACGTGGATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCT
AGAACGTTCGGCTCGTACCGGATTCAAATCCGGCGAACGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAA
ACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCCCGCCACAACCGCGACACACGTAGAAGCAATGATCCCCGGG
ATGCCCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTC
CCGTCCATGAAATCTCGGGATCTTTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACG
CAGTGAGACAGACTCGACGATAATCTTCCGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTTAGTCGGGCACCGTGACTTGGTGGACACGTCG
AGCTGGGGCCGTAAGCGTCGGAGCTTTTTGGCGATACTTGCCGGATCCGACTGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACT
TCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCA
GTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATACATCTGATCTGCGGCG
AGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGAACAGCAAATATGGCCACTTGTTCCTGGT