Description :
From Genome Similarity Track
Location :
Scaffold_1236:25- 1435
Sequence
1410 bases(100 bases per row)
GCGATTTGGTCAAGCTCTTCTGCATCAAAGACAATCTGAATCTACTCTTTTCGTGACGGACAAAGAGCACACAGACCAACATCGCTAGCGTCCATGTATA
CGGTAATATCAGGTGATTGCGATTGCGCGAATCGTGACAGCGGTATCCAGTTGAGGTTTGCCGTGTTTAGGATCAGTCCAAACCACAGCAAATCGTCTCG
AGCCCCGTTGGATAGTGGGGCTCGACTGAACCGGCGAATCGAACGACACAAGGATGCTAGCCGTTGGAAGCTCGGCGCCGCTGACCTGACACAAGTCACC
ACGTGACGCAGACTACCGATAAGTTTTTCCAGGTTGGACTTTGACGTGTGTTTAGTGGCCAGCATGCCCTCAACTTGCAAGAGGGCATTCGCGATATTCT
CTGGTGGAATCGCCACGTAGGATAATCGAATATTCCAATGTAGACCGAGTGCCCTACCTGTAGTTGCCCAATTTGTGAATTTGTCTTCACTAATTGCGTC
AGGGCCTCGGACCATGATCATCGCCTCGCGTAGCGCAAGAGCAGCCTCAAAAAGTCGCGTGTCAATGTCTGCTTCGATGACGTTATGGTCGTCACACCAA
GTCTTTGAATCGAACGGCCGAGCTGCGTGAGCAGGTTGTGCCAGCCAGCTGGGTTTTGCTGCGGAGTACAGGCGCGCGATcgcaccaccagcgagccAAT
ACTTCACCGGCGAAAAATGTCCATCCGAAAGGGCAGGCAAGATCAATCACGAGGATGTTCAGCTCACGAATTACCCCCGCAAACCGTCCAACATGATCAG
CGTGAATAGGCACATTGCGAAATGCTCCATTTACGTCCCCCAGATAGCCGTTTTGTGCGACCAGGAGATTGGGACTCAACTTCTAGAACTCGACGTGCCA
ACGCGTGTGGTCCATCGTACTGAATGATGACCGATCCATCGTCGACGGAGTTGTCATTAACGGAACGCCCAGCCGGGTATGATAAATCACGAATCATCCG
GGCATCCTCCAAAAGCGGCGCAGAGCCCTTCGGTGCTGCTCCGAACGGACTACAAGTGATTCCTGGCAGGATGTCCAGTAATTCCAAGTCGAGACCGAGA
TACTGGTTACGGTCCTGACCTTTGCGAATGCTTTTTAAAATCGATTGCATTGCCACTGAAGCTGATGCGTGGTTGGAAGGAGGTATCGCCTGAGTACAAA
AGTCATTTTCCCATTCTGGAATAACTCCATGACGTACCACAGCCTCCCACGCTGATCGATACTTGTATGAGGACCACCCGGCAGATGACTTGGGATTTCC
AGGGCCTTATTCGGACGAGGATCCAAGTCCGACTCCCCGCGCAGAAGCCGAACAAATTCGGGTAGATGCATACCAGACCGGCGAAGGAATTCGCTAAACA
CGCGCTGTTT