Description :
From Genome Similarity Track
Location :
Scaffold_3725:25- 1401
Transcript NameFunction/comments
Phypl_g15997hypothetical protein

Sequence
1376 bases(100 bases per row)
ACCTCCGCGTATTCCGGGGTCGGCCATGACTGCCTACCGCTGAATCGCTGGATccgcgagatcgacatcgcGATCGCCTCGAGGCGAAGGTGAATTTATT
CTTTTCCCGACTGACTGGGAAACCAAGACGTGGGCGCTAGGCCGGCTGGTGACCGACACCACCGCCTTCCCCACTCTGGGAGCCATCCAGAGTGACCTGC
GCCTCGCACTCGNGCCCTCCGACAAGGGAAGACCTCCATGCGCGACTACGTCCAGAAGAGGCGCCACCTGGTTTCGTGCATCGTTACGAACCCGATCGAC
GTGGCATCTCAAGTGCAGGTGTTCATCTTTGGAATGCGTGAGAGCATGACGCGGTACTGCCTCACGAGAGCGGACTTGAGGCTGCGTTCGCTCTCGCGTT
GCGCGAAGACAACACGGGGGCATCCTCTTATGCGCGAATGCTGACGACGGACGCTCGGGCCTCCGCGCCCGGGCCCATGgcgatcgacgccatcgaaGCC
GAGTCGAGATCGTACAACACCTCGAGTACTCGAGGGGCTCAATTCAACAACGGCAATCGACAGCTCACCTATTTCCGCTGTCGCAAGCCGGTCCATCACG
CCGCGCTCCGACTCCGGTCTTGGCAAGCGCTGAGGTCGTCGGCGAATCCGACGACAAGTTCTCGNTGTGCTGTACGCACAATTCAACGCCACCATCACGT
CCGGCGACTCGAGACTGATCCTCATCAGTCTTCACGTCGCCGGCGCGGAGCGCCGCTCCGCGCGTTGCTTGACTCCGGAGCCACGAACAACTTCATTCGT
GACAACTGCCTCGCTCTCCTTCCATCGCACGTGCGCGTTCGCGAAGGTCCGGGCGACATCGTCGTGAAGTTGGCTGACGGCAAGCCACACCGCGCTCCGC
GGCGCGCTGTGTCGTTGTCGTACAAGTTCGACGGCTTCTGCAccaacgacgacttcgtggtgATCGAGCTGAACTACGCCTTCGACTGCATCTTGGGGAT
GCTGTGGTTAGCTCGCTACCAGCCCGAGATCGACTGGTTAGCCCGTTCGGTCCGGCGCCGTGTCGGgtacgacgccagcgaggTGTTCActcacctcctc
gtcgccccGACCTCCCATGTCTCCGTCGTGGACCGATCGTCCACGACACAACCCCCACAGCAAGTGAGCGATGGCCCTCGCTGTGCGGTGTGTGCGACCA
CCGTCGCGGATTCACGCGgtcgagcagcggctcccGCATGTGGATAACGCGGTCGAGCAGGGGCTCCCGCATGTGAACGATGCGGTCAAGCAGGGGCTTC
CGCAGGTGATTGCGACGGTCGAGCAGGGGCTCCCGTCCGCTGATGATTCCGTCGCGCAGGACCAACATCTGCGCGA