Description :
From Genome Similarity Track
Location :
Scaffold_1360:25- 1192
Sequence
1167 bases(100 bases per row)
TAACCATGGAAAGAATTGTGCTGCTCATCTCCGGCCATGACAGCGGCCCGACAGGGCCCCGCTCGTCACAGCACGGTGTGCCGGTCGGCCGAATACGTCG
GCTCGACCCATGGGCTATGGTCAAGCGCTGACCACAGCCATGAAGCGTCATGCTTCAACGTCGTGTTTGCTTGAGCGACCATGGCTGCTTCCAGCAACCC
GCTCATCATACAGAGCAACGCGGCGGACTTGTCTAAAGCCCTGCAGCGCGTCACGGCCATCACGTCGCCGACGCTAAGGTGTCTTCCTTCGACACCAGGG
TACCGCAAGGGTACTTCATCGTGGTGTGGGGTGTATTGCCCTCCGTCACCGGCGATTGCATCCTGCGTCGCGGCGACCAACACCAGGTCGGTGTGCGCGC
AAGACCGCATGGCACACAGTCCATACAGGACCTCAAGGTGTACGAGGGCACCGCCTCATACACCAAAGGCATGTCGTGTATGACACGTACCACGACTGCC
ATAAGTGCCTCGTGCACCTCAAGTGCCACGTGCACAAGAAGTGTCGCGTGCACTGCGGGTACATCGCGTACACGAAGTGCCACGCGCACAGTGAGCGTCA
CGCACCGCGACTATCTCACAGGTAGTATGTGCCGCGTGCACGCGTATGGCTTCGCGCCTTACAGGTGCGGTATGTGCCGCGCCAACTGTGAATGTCTGCA
AAGGCAACACGTTCGGGTTCTCCCCTCGTGGGTAACACCCATGCTCGGGACTGATGGCTATCTGGTCGGCAGACGTGCCGCACCCAGCGTAGCAACAGCC
TGGAGCTTTGGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN