Description :
From Genome Similarity Track
Location :
Scaffold_4463:25- 1135
Sequence
1110 bases(100 bases per row)
GATAGTCAGACGTGGATAACCCACATCGACCACGTGCGAGCGGTGCTCGAGTGCATGCAGCACTAATATGTTGTATGGCCAACTTGCACAAGTGCGTCTT
TGGCGCGGAGGAGATACCTATCCTCGGGTGCTTCATTGGGAATGCGTGGCGTACGGGCAGATCCTGCCAATGTCAAGGCCATCGTGGACTGGTCGGTTCC
CAAGAATCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTC
CTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGG
ACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCAC
GTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACAC
CTGCTAGGCTCTAAGTCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGC
CTACCAGTAAAACCGGTTATCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTAAACGCAAACAGATGATTGGACGAACAGGATGA
TTGGACGAGTCCATGATTGGATGCACCAAATGATTGGATGCAGACTAGGACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATC
TAGTGCACAAACGACCTTCCTTTTGTCGCCTCATCTCTCTCAGAGAATGCCAAGATGGCTTTCCTCCTTTGCCGAGTATAACTTGGAGGTGAAGTACAAC
CCGGGCCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTCCGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATAC
CGCGGAGCGG