Description :
From Genome Similarity Track
Location :
Scaffold_690:25- 1114
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20493hypothetical protein

Sequence
1089 bases(100 bases per row)
TCAGCAATTTTCGCAGAACCACTTCGCCACAATGGTGCGCGTGCCCGGATCTTTGGGTGCCTCAGGATATCACCGTGAGTCCCCAGATGAAGAAGCGCAA
GCTGGAATTGGACTAGGGAACGAAGCGTCGACGGGTATTGGATCACCGTCGACTTCGCTAAAATCAAGATCGATCCACAGATCGGCAGAGTTTTGGGAGG
AGCTCTACCGACGGAACAGAGGGAGGTCTGGCGACAGACCTAGAAGAAAAACCTCAACCTCCTCCCCAGGTCCCTTCGGGGACCCCTGCGGGTTCTGATT
CGCATTAGAACCCGGTGGACGAAAGTCCACCGGCAAAAGCCGGGAACGTCTCGGCCAAACAACCGCCTAGCTCAATATCGATTGTCAAGAAGAAGCCAGC
TAGATCGAAGTCCTCGCGAAAGAAGCTGAAGGCACCAGACTCGGACGTTGACGATCGCATCGATCTTACGTCAGCTTGGACGAATGAACAACTCGAGAGC
GTGTATCACAAGAAGCAGCTTCACGCTTTTCTAGCTGAGGATGCTGTGATGCGCATCCTCCGTCCGAAGCTGCTCGGTGATCTGAAAGGTCCTGTATCTG
AACCGGCCTTGAGATCGAATAAGTTGGACAACGTGAAAGCAACGTTACGTTTGTTCAAGTAGTCTGGAATTGTTGCTGGAGCATTTGAGCTAACGATCTG
TTCGATCTTAGCGAAGAGGTCATCAAGGCTGTACCCAAGACGCTGTTCGAGTTGTTGAAGCCACTGGTGGATGGAGTCCACACGATCTCCAAGAACGGAG
GATCCCCTTGTGATTCCCCAAGAGACGATCACGACGTGTCGTCTTCCCATTATGAGTCTGCAACAGAGGAGGTGGACACCGACAGTGTCGATGACCCGCC
ACGAACGACTCTAGGTCCATCCGGAACCGCGATGCTACGAGATCGAGCCGCCTAGAAGGCTGCAAGTTCACCCACGGAGAGAGGCTCCGCTGTCACAGGC
GTAAATCGGTATTCGCCAGAGAAGCTGGAGTCCTTTTTTCAGTCGGCGATGGGGCGATTTCTCGAAGAACAGCGGACAGCGACGGCGCC