Description :
From Genome Similarity Track
Location :
Scaffold_2034:25- 1106
Sequence
1081 bases(100 bases per row)
TGTGAAACAGGAAAGAGACTACCAGGTGATCGGAGTGGATCACCTGGTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGTGCGAGCAAGGCGATATGTCATGATCGCAAGCCGGGATGTATGTCCGATTTCTTCCAAGTGT
TCAATCGTATCGCGGGACAAAACAGCGAGCCACCATGGCATTTAGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCGATTGTCTTATGCAATTAGCACT
GCTCATGATCGAATTCGAGGAGATACNNNNNNNNNNCGATACCCCATTCTACCTGATTCATGGTTGGGACCCAAGATCAACCTTCGAAGCTACTTTACCG
TTGGGAAGCACTAAATTCCGAAATCGAGATGCACGAAGGTGGAGATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAGCCCATATATGGCATGGACCTTTTTCGGATGGCCGAAAAGTGCGGCGATCANNNNNNNNNNTTTCGAGTGACCAGAAGTGCGGC
GATCACGCTGTAAAGTTGAAAATTGCGGGTACCCGTACCGGCTATTCCCAATGATCACGCTTCTAAGTTAAAGCTAGTTCG