Description :
From Genome Similarity Track
Location :
scaffold_27:249984- 251882
Transcript NameFunction/comments
Plaha_PHALS_09411Acinus (induces apoptotic chromatin condensation)
Plaha_PHALS_09412Armadillo-type fold

Sequence
1898 bases(100 bases per row)
GTCGTTCGCTTCAGGTTAAATTTGTTGATCATACGGCTATGGAGGTAAGAGTTTAGCAGCGTTGAATCGGTCGTTTTTTGCTTACTGTGCACTTGACCAG
GTCGTGCAATCTGGTGAAGCGAATATACCGAGCCAACCGAAGATTAAAGATAGTGAAGTCACACCATCAACTCAGCGACAAGGTAAGTTATTTGTGTTTC
AACATAAGTAGCGAATGGCTAATGGCAATTATTCCGTCTAAACCAGTGGTGACTATCGAcgaattttttcaaaagaccGAAACAAAACCTGTACTCTACT
ACTTGCCACTCACTGACGAAGAAGTCAAGGAGAGAAAGCAGCGTCAGGGTCAGCAACCCATGGGCCAGCCGCGAAAACGTCGCCATCGAGGCGGTCGTAA
GCGGAACAGACGAGGTCGTTTTCGTCGCTAGTGatgacacatctcatcatGCAGGTAAACAAAACTCTGTAGCTCGATTTAGTATGTTCGACGAGGATGA
GTACCTTTTCCAGCATTAAAAGGGCTACACAGATGTCCGTCGTCCGTAGCAATAATATAGAGCCAGTATCCTGCATCTCTCCTTGAGATAGCGTAGAAAT
ACTCTTCTTTGTTTTCTGTAGCTGTTCTTGCCTTTGTAATCAGCTGGTAGACTTGCATAAAGCTCAAATTTTGCTTCAAGAGCGAAAAGTCGGGtgagag
cggtgctgccTATATGATTCGAGTTTCGCGCGCAAGGAAAGGCATTTCCCTAAGCAATCATAGATAAAGTTTATGTCAACGCTTGAGCCACCACGTGAGA
TTCGAAGCCGATTGAATATTCAGGCAACGTCTAGGTTGTATCGAGAGCCAACTCTGGGGTTTACAGCATCTAGCCACCACTCGACATTTGTCAGTTTTCT
GACGTTGTAATTCGAAGTAGAACTATCCTATCCAGATttccatttcttctgcattcGATTGCAAAACGGCGACAACTTGGGAACCTGGTTGCCCACTTTG
ATAAGCATATTGCTCACAGCTAAATTGCCAGCATTGACCTTGTGTAACAGGTCTACAACGTCTTCACAGAGCGCAAGTATCTGCGCTTTTTCATCGTTGG
AGGGTGTAAATTCTGCACAATCATCGAAGATCTCGCAGAACGCCACAGCACGTAGAACACCAACCAGTATTTGCTCAGTGTGGGATGCAATGCGAGGCCA
TGTAGCAAGTACAGTCGCTTGTAGCGCTTCAAGTGTTGTGACCAAAAAAGTAACATTGACACTCTCAAAGCCTGCAATCAATACTTTCAGTAATGGTTGT
AGATATCGAATTGCATTAAGGCTGTGTGGGGCGCCTTGGCGAACAATCAGAACTTGCAAATGTCGGACGAAAACCACCCGGATAGAAACATCAGTGCAAA
GACTCGTGTCGCGGAGTAGACGAGGTATAAATCGATCGTAATGCTGAACGTTGCCAGCAGCAGATACCTTGTCAAGCGATTCTACGAGACAGTCAAGTAA
CACGTCAAGCGTTTGTGGCTTGCGAGAAACGAGTGCAGTATGAAGCACCTCCAGCAATACATCTGAATACCATCGTAGCTCTGTTAGTGTGACATTATGT
ACAATATGACGCAGCATACGTGCACCAATGAGCTGCGTTGAGTCTATCAGATCATCCACAAGCGGAAACGTGAGCGCCAGCAGACGGCCGAGTAGATCCC
CGCCCAAATACGGAAATGGTATTTCTTCTACCAATTGCAGCATAATCTTCTTGTTGATCGACGCTTCCGCCACCCATTCCTCCTTCTTCACGTCTTGCGA
GCATAGTGCCACAATCTGCGAGGCGTATTTTGCTATTAAACACGTTCGATCTTCAGCTTTTGTGAGCTTCACAGCCTCATCCAGCGTTTCCTCAGCAA