Description :
From Genome Similarity Track
Location :
Scaffold_70:24996- 31923
Transcript NameFunction/comments
Phymu_g3378hypothetical protein PHYSODRAFT_312327
Phymu_g3379hypothetical protein PHYSODRAFT_484119
Phymu_g3380hypothetical protein
Phymu_g3381conserved hypothetical protein

Sequence
6927 bases(100 bases per row)
TCGTGCTCTTCTTTCACGTTTTCAACGCGATTTACTCATGTTCACTCGCCTACATTTACCACTACCTGAAATCTCCTGTAATGGACTACTACGTGCAGTT
GCTACAGATGATGCCGCAGGAGAATTACAACGTGATTATTTGTCTCTATGCTGGTATCGGAGCGGTGAACTTTTACAGCGCAGTCAAGATGTCACTCTAC
TCGATGTATTATCGGCGGTTGGTCTTTGGCCAATTGACAGATCTTCGCACGGAAAAAGATACCGAAGACGACACTGAGGTAAACGACCAAACCTCGGGCT
GGACAACGAAGCTGCACTCTTTAAAGCGCTTCGCATCAGGGTTTGCGCGGGCAACCAGCGCTCGAGGCGAGTGGTTTGATATTGTCTTGCTCTTAAGTGA
GGTGTCGGAGATCGCGTCACAGACTGTCCAGGCGTATTCGTCCAGCTTCCTTATCAGCAGCGTTTGGGTAAACCAAGTATTTGCGGGGCTCATCTTCCTG
AACACCATTGCAAACACGCTCGTTCACTATAATTTGGAGGAGAAAGTCGGGTTGAGGCGGCTGAGCAGCACTGCGATTGACCTGATCCTTGATTTTACGT
GGGGGTTCGTCCTCCCTGGGAAGATCATCTTTGTCTACATGTTGACGTTCGTGAAGTACCATGGCTCGTTCCCAGTCGAATTTAATTACTCCGATACCCT
ACAAATCCGGGCAATACTCGAATGCAACCAGTTTTTCATGGTCACGTGGTTAGATGCGGTGACTACGACGTTGCCTTACCTGAACATGCTGTCGGGTCTG
CGAAGCGTAAAATTCCTTATCCAGCACGACATGACACTGGTTCGAGTTTTATCATCAACGAGAATCCAGCCTATCGGACCGTCGGCAAGTCTTGCGAAGG
CAAAAAGTGTTGTTGTTAATTCAACTGTACCTCCACCTGCAGTTAGGGCAAAACGTGAGGCGAACCAAGTAGAAGTCAAGCAAAGCACCTGCGGCAGAAG
AATCACAGCCTGCGTCGTGGCGCTGTTGCCCCTGTGTGGATTATTTGTGCTGCTCACATCTATCATTGCGTCAGGGATATTTTTCAGCAAGGAGGGGTCG
TGTAAGCCAGGTTGCAAATTGCAAATGCACCCGTGGTTTACTTACCAGTGTGCGTGCTCTGTCATGGAAATCAATTGCTACGAGAGAGGTATTACCGGGC
TCGAGGACGAAATTCGAGATATTTTGCAGTCTCTGGAGCCCAAAGTGCTGAATTCGCTCATTATTTCTCACTGCTCCGAGCTTGTCGTCCCGGAAGAAAT
TCGTCACTTCAGTAAGTTGATGGCGCTTGAGTTGTATAACGTGACGGTGACCCACTGGCCAAGCACGGCCTCATTGTCACTCCCTTATGTGCCGTCTCTC
ACCACGATATTCATCATACGATCTCGACTCGTAGGCGGCATCCCGGACGGCTTGACGTCGGACTTGTCCCCCAATGTCCTGGACATTGAGATTGCGGCCA
CCGATTTTGGGGTCCCAATACCAGACGACCTCGACGAGAAGTGGCCGAATGTGGGTTTGCTGTACATTGAACACTGCAGACTGCAAGAGTTCCCGAAGGC
CTTGGCCCGTATGGCCTTGACCGACTTATCGCTGGCAGATAACAACATCTCGAGCGTCCCTGAAAGCCTCAGCGACAACTCTATGTACGTCGTTCTGGAC
CGGAATCCACTCGAGGAGATCCCCAGTGGATTCGAGTCCATGACCGAGATATTCTACCTCACCGTTCAGTACACGAATATCGTCACTCTACCACATTGGC
TCCAGAACGCTGGAGCATATTCATTCAACTTTCGAGCGCGGGGAACTCCCTATTGCCACGGTTTACCCCCAAACAGCCCCGAAGCAGCGTTCGCGTGGTG
CATACAGGACGATTTCAGCAACGGACTCTTCCCGCTTGCCATGAGAGATGCAGATCGAGCCATCAAATAGACGTACTGTACTGTAATAATGTACCATCAA
GCAAGTGTGTGGTAAACTACGATGCTCCCCGAGTGGATGACGACCTCGTTCCTCTGTAGctcaccagcttcttgcacCAGGTCGAACCAGTGATTTGCCA
CGCGTGTCCGTCTCAACAATCTCATTGGTTAAATCGAACTTTAAACAAATATGATTGGACAAAGCGCGAAGTGATCCGATTGGTCAGAAAAGCTGACCAA
TCTCAACGTAATCGACCTGCATTCTTTGCGCAACCTTCGTTCGACCTGCGCGTGCGTCAGCGGTCCACACTCAGTCACACTTCGGGATCTGCTGGAACCA
TGTCGTTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGCGTCTCGAGGCCGCGCATCGCGCTCCCGCGTCATCGTCCTTATGGATGGGTCGTCG
CCGTCCAGCGTCGTTCGTGCTGCCTGCCTTCTCGACGTCGGCTCTGGATgatgacaagaagaagacgaagacgtcgctgcaacagcagaagaagcccaag
acgcTCAATGCACTCAGTGGCATGGGGCTGGACCGTCCGCCCGATACGGCAAAGGAGATTCTGAGCTTCCTCATGGGCCACCTGTGGCCCAACGAGGACT
CCAAGGAGGCCAAAGAGATCAAGCAGAAGGTGCTCATCTCGGCCGGACTCGTGGTTGCTGCCAAAGCGTTGACCATCCAAGTGCCGTTCATCTTTAAGGA
GCTGGTGAATAATATGGGCGAGGTCTCCACGGCTCTGGCCGGGTCACCGGAGATCACAGTGCCACTGGCCATGGTGCTAGGTTATGGACTCGCGAAGTTC
GGTGCCAGTGCGTCGTCCGAGCTGGCCAACGCCGTGTTCGCTACTGTGGCTCAGAAAACCATCCGCAAGGTTGCAGTGCGTGTATTCCGACACCTACACG
CTATGGACCTGAAGTTTCACCTTGACCGACAGACGGGTGCTCTCTCGCGTATTATTGATCGTGGTTCAAGGTCCATTGACTTTGTGCTACGTGCCATGGC
GTTCCGAGTGGTGCCAACAGCGCTAGAGATTGGACTGGTGAGCACCATTATGGCGACAAGTTTTGGACTGCCGTACGCGGGTGTGACGCTCGGCACGCTT
ACGGCGTATACGGCATTTACGGTGATTGTTACGCAATGGCGCGACGAGATCCGTCGCGAGATGAACCGGCGTGAGAATGAGGCTGGCGCAAAGGTTATCG
ATTCGTTGATGAACTACGAGACGGTCAAGTACTTTAACaacgaagagcacgaaacCGAGCGCTACGACGAATCATTGAAGGGGTACCAGAAAGCggcgct
caagacgcagacgTCTTTGGCAATGCTGAACGCTGGACAAAACGGTATCTTCGGCGTTGGTCTTACCGCAATCATGTACATGGCATGCGAAGGAATCGCT
GCAGGTAGTCTCACTGTGGGTGATCTGGTGCTTGTAAACGGCCTGTTGTTCCAGCTCTCCATCCCACTGAACTTTATTGGTAGCATCTATCGTGAGGTCC
GCCAATCAGTCACGGACATGGAGTCCATGTTCAAGCTTGGAGCTGTTACCCCTGTCATCATGAACCCTGATGAAAACCTAAGTCTGACCGGCAGGGAACC
CAAGTCTATCGAGTTCCGCGATGTCGAGTTCGGGTACCGCACGGATCTCCCGATTCTGCGTAAAACTTCGTTCAAGGTGGACGCTGGTAAGCGTGTTGCT
ATCGTTGGCACTAGTGGTTCCGGAAAGTCTACGGTGCTTCGATTGCTCTACCGCTTCTACGACCCGCAGAACGGCACTATCCTCATTGACGGGAAGGATA
TTCGCCAACTGAGTCTGGATGAGCTGCGTCAGGCGATTGCTATCGTTCCGCAGGATACCGTGCTGTTCAACGACACGATTTTCTACAACATCAACTACGG
TCGCCTGGACGCCACTCCGGAGGAAGTGATGAACGCTGCCCGTGTCTCTCAGATCCACCGTTCCATTGAGGCATTCCCAGACGGATACAACACTCGCGTG
GGTGAACGTGGATTGAAGCTCTCCGGTGGTGAGAAACAGCGTGTATCTATCGCACGCGCGATGCTCAAGGACGCACCGATCCTTCTTTTCGACGAGGCGA
CCAGTGCCCTCGACTCAGAGACCGAGTCGGAGATTGTGCGCGAATTTGCGGCTATTGGCGAGAATCGGACATCGCTGATCATTGCTCACCGACTTTCGAC
CATCCAAACCGCCGACGAGATCATCGTATTCGACAAGGGCGAGGTGATCCAGCAGGGGTCtcacgaggagctgctgcgcgatGTCGAGGGCAAGTACGCC
GAGATGTGGGCTCGCCAGAACCATCACGTGCTCGGCTTGCttggtagcagcagcgacagtaAGAACACTGGGGAGAGTGTATAGAAAGCTCGTGGTTGTA
GAGATTCACGTGCATGACAGTCAGCGAAAAAGACAttcgagcacttcaactacTGACGTAACCCCATAAATGTGTACAAATGTGGAGCTTTTCGTGTACG
TACTTATAAAAGGGCGACGACCATTTATTTATGTCTGCCCTAATTGCAAAAAGTAAAAATAAATTTCTTCACAATTTTACGCCCAtgaacagctcgagca
gcgcgagttccagctcgtacagttccagcgacgacgagccgCTCAGTCTCAGCCTCAAGCGCCCCAACGCAatgcctcctcctccgcccCCTCCACCCGA
CTCACCCCCGCCCGATATGAtgctgcctcctcctcctcctggcCCGCCGCCACCCATCAATACAAAGCGCAAGTCAACGAGACCGCGACGGACGAAGACC
AACACTCCGACATCAACCAAGAAAccagtgaagaaggtgacgtcCGCCCCACGCAGTAAACGCAGCTCGATGGCGGAAAATGCAGTCGTTAAACAGGAGA
CGAATCGCCAGAGGTCCCCAGTGAAGCAGCAATGGGCTGACACCTCCACAGCTGAGAGCgcacaggaagaagaggaagatccaGACGCGTACTCGGACGA
GTCAGATGTGTTCGaagaggacgtggaggcaATATTAttcgctgaagaagaggaagaccGACGCAAAGGCTACACCGACTGTCTGACGGAAACGCATTTG
GACAGCACAGAGTACCCGTATCCAGCGTACCTCGCCAAGCTGTCGCCACTGTTCACGGAGCAAAGCGTTTTCGGGAAGAACCCGGAGGACTTTATTTATT
GCAACAACTTGCTGGTGCGTTGCAGGCAGGGACTTAGattgtggacgaagctgacgatTCATTTTTTTTGTGGCAGGTTAATCCGAGTCAGCTAAAACTG
GTAGACGCTCGGACGGCTGCATTAGAGCgggagaagctgcaccaaGTGCGAAAAGCGGCAGAGTTTAAGGCGAAGCAGGaaaggaagagaaggcgtCAGG
AGAGGTGAGCAATTCTTACACGACGCTTGAATTGAGATTTTCACTGACACAGGGACTTCAACAACTGTGTTGTATTTTCAGACTCGCTGAAGCGTTAGAA
CCGCCTGCGAAGAAAATCAAGATAGCAGAAGCCACTTTGAAAGCTCTGGAGTCGAAACAAACAGCATTAGtgagcagctcgagagctACTTCCAGCGCCT
CTCGGAAGCGAAGTCGAAAGAAGCCTGTTGCATCTGCATCTACGAAAGCTACCACGCCAGCCTCATCGAATCCGCCGAGCGATGCTTCCACAAGTAGTGC
CAAGAAGACTAAAGCGAAGACCTCGCCGGCACAGGGAAAAGATAATGCGAAGATTGCCGCAGCTGTCAAGAAGACGCCACCCGCTTCCAAAAGCCGTACC
AAGAAGACCACAGCTGCTTCAACCTCGGCAACTACCAAAACTACGACTGCAACTACAAAACCCCTCAAgccagccaagaagacgcaagCGAAACAAAAGC
TTGCAATTTCTGCTAGTAAAGCCAAGGAGATCAAATTGCAAGCAGAaatcgagaagaaccgcgCCGAGGCCAAGGTGGATCTTGGGAGCGAGAGCTCGTC
GAGCTCatcgagctcttcctcctcttcttcatcgtcctcttcatcttcttcgtcgtcggtATCATCTGTATCAAGTAGCAGTAGCTCATCTGACAATGGC
ACCAAAGACAACTAGGCACCCAAATGGAGAAATGGCCGAACCGAAACAAAAGTTCTCGtttaattaaaaaaaaaaatgaacGAGAACACAAAATGCTACC
CGTACACACATTTGTTCCCAATTTCAGGTAACGTGTTTCTCAGCCCAGATACTTGCAGATTTCTTGCCCAACTCAAAAAGCTGATCTAGCTCTTCAATTG
CCGGTGGAAACAGAGCAAACCGAGCCAGCTGAATAATTGTGTATGGAAAGTCAGGGTCGATTGACGGGCTGATCTCGTAGTCGTCCCGACGCAGCACGTG
GCCGTGGAAGGCACACACCTTGACGTACCCAGGGACTTCTGGTACCAGAGTGAGCAGTCCTCCGTCCACGTGATACTCTCCTCGAAAGACCGATGTTCCT
CGTTTGGCCAGGTACCAGGGAATATAACACGAGGCGATGAGCGCATCACACAGGTCATCTGTTGAGTGGAAGTCATCGGTCAGTATCAGCGCTCGAGCAG
GCCACATCTTCTCCGTGGCGATTGTCAGTCGCTGCGCCAATGTCTCCACTGGGAGATCGCCGAATTTGGCGTGGAAGATGGCACGCAGCCGCTCCTCAAG
CTTCCAGATGGTTCCTTCGCTATGACAGAGTTTGGCCATGGTTTTGGTCTCTTCGTGGATGTCACTCATACTCGCGTTGGCCGCCAGAGTCAATGCAGCG
ATGGCGCCTCCTGAAGCTCCCGCGAACTTAGAACTCGACTGGATGAAGCCTGTATCCTGCAGCCCCTGTGCCACACCCAAATGATATGGGATCAGGAATC
CACAGCCACTGAAGCTGAAGTTACGTG