Description :
From Genome Similarity Track
Location :
contig_31:249911- 251212
Transcript NameFunction/comments
g7501.t1hypothetical protein

Sequence
1301 bases(100 bases per row)
CGGCAGCGAGGGGTGATATGAGGGTCATGAAGTGGCTAGTCGAACGATATCCGGGGTTTTACGTAACGTTGGCTGTGGAAGAAGCCGCGAAGAATGGGCA
TCTTGACGTTCTGCAGTGGCTCCACCGACTTGGCCGAGCAGGAGACGCACGTGATCCAAAAGGAGGGAAGAAGAGTCCCCTGCTAGACGTGTTTTGGGGC
TCAAGGGAGTTGTTTTACGCCGGCCAAAACGGACACTTGCACGTTGTGGAGTGGCTGCAGGAGCACACGAACCCGACACCGACGCACATGTTCTTCGTGA
CACTGGAGGAAGCGGCGAAGAACGGAGATTTCGCGATGGTAAAGTGGTTGTGCGAAGTACGCGGAGAGCAGTCGTCGTACGCGTCGGTCCTCGCAGCGAG
TGAGGGCCACTTGAATGTGCTGAAGTGGCTGCGAGGCAACATCTTCAGTCCGTCTCCCTCGGTGTCGATGGATGACGCTGCTGCTAATGGCCACCTTGAT
GTTTTGCAGTGGCTGCAAACGAACGCGGGATACGCTACACCTACAGCGATGAACAAGGCGGCAGGAAATGGACACCTCGCCGTGGTCAAGTGGCTGCATG
ATCACCGCAAAGAAGGATGCACAACGGTAGCAATGGATCTGGCCTCTGCTAACGGGCACCTCGCAGTTGTGCAGTGTCTGCACACGCAGCGACGCGAAGG
ATGCACGAAGGCAGCGATGGATGAGGCGGCAGTTCATGGTCATTTGAGTATCGTCCAGTGGCTGCATCAGACTCGCACAGAAGGGTGCTCCGCGCGAGCA
ATGGACGGAGCCGCGATGAACGGACACTTGGCAGTGGTGAAGTGGCTGCATCAGCATCGGAAAGAGGGCTGCACAACGGCTGCAATGGATGGCGCGGCGG
GAGCAAACCACCTGGATGTAGTACAGTGGCTGCAGCAGAACCGCAAGGAGGGCTGCACGTCGAAAGCTATGGACTCTGCAGCTTGCAATGGCCATCTGAA
GTTGGTGCAGTGGCTTCACGGGCATCGAAAAGAGGGCTGCACAGTCAAGGCGCTGGATCAAGCAGCAGCTTTCGGCCATTTATCGGTAGTACAGTGGCTG
GACGGGAATCGCAAGGAAGGATGCACGTCCAGCGCGATGGACAACGCTGCTGCGGGAAGTCACCTTGACATTGTGAAATGGCTACATGGCAATCGAACGG
AAGGCTGCACAACGGCGGCGATGGATCATGCAGCAGCTAATGGCCATATTGAAGTGGTCCAGTGGTTGCACACGAATCGAAGCGAAGGTTGTACTGGTGC
A